ID: 986664802

View in Genome Browser
Species Human (GRCh38)
Location 5:10091974-10091996
Sequence AAAGAGCAAGCTCCACTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986664800_986664802 -10 Left 986664800 5:10091961-10091983 CCCAAGAGCAATGAAAGAGCAAG No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data
986664796_986664802 15 Left 986664796 5:10091936-10091958 CCTACCCAGCCGCTGCAGTAGGA No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data
986664794_986664802 25 Left 986664794 5:10091926-10091948 CCAGTGCTTGCCTACCCAGCCGC No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data
986664798_986664802 10 Left 986664798 5:10091941-10091963 CCAGCCGCTGCAGTAGGAGTCCC No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data
986664797_986664802 11 Left 986664797 5:10091940-10091962 CCCAGCCGCTGCAGTAGGAGTCC No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data
986664799_986664802 6 Left 986664799 5:10091945-10091967 CCGCTGCAGTAGGAGTCCCAAGA No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986664802 Original CRISPR AAAGAGCAAGCTCCACTAAC AGG Intergenic
No off target data available for this crispr