ID: 986666039

View in Genome Browser
Species Human (GRCh38)
Location 5:10105088-10105110
Sequence GGTTTGGTCTTTGTAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986666039_986666046 22 Left 986666039 5:10105088-10105110 CCAGGCCTTACAAAGACCAAACC No data
Right 986666046 5:10105133-10105155 TGCGTTTCACTCTGTAGAAGTGG No data
986666039_986666047 23 Left 986666039 5:10105088-10105110 CCAGGCCTTACAAAGACCAAACC No data
Right 986666047 5:10105134-10105156 GCGTTTCACTCTGTAGAAGTGGG No data
986666039_986666042 -3 Left 986666039 5:10105088-10105110 CCAGGCCTTACAAAGACCAAACC No data
Right 986666042 5:10105108-10105130 ACCTACTCCGCTCCTGTGACAGG No data
986666039_986666049 25 Left 986666039 5:10105088-10105110 CCAGGCCTTACAAAGACCAAACC No data
Right 986666049 5:10105136-10105158 GTTTCACTCTGTAGAAGTGGGGG No data
986666039_986666048 24 Left 986666039 5:10105088-10105110 CCAGGCCTTACAAAGACCAAACC No data
Right 986666048 5:10105135-10105157 CGTTTCACTCTGTAGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986666039 Original CRISPR GGTTTGGTCTTTGTAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr