ID: 986671422

View in Genome Browser
Species Human (GRCh38)
Location 5:10146368-10146390
Sequence TTTGTCCCTCCTGATGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986671422_986671425 -1 Left 986671422 5:10146368-10146390 CCTCCGTCATCAGGAGGGACAAA No data
Right 986671425 5:10146390-10146412 ACACCTCTTCTGTACAGGCCTGG No data
986671422_986671424 -6 Left 986671422 5:10146368-10146390 CCTCCGTCATCAGGAGGGACAAA No data
Right 986671424 5:10146385-10146407 GACAAACACCTCTTCTGTACAGG No data
986671422_986671428 9 Left 986671422 5:10146368-10146390 CCTCCGTCATCAGGAGGGACAAA No data
Right 986671428 5:10146400-10146422 TGTACAGGCCTGGGTCTCAAAGG No data
986671422_986671426 0 Left 986671422 5:10146368-10146390 CCTCCGTCATCAGGAGGGACAAA No data
Right 986671426 5:10146391-10146413 CACCTCTTCTGTACAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986671422 Original CRISPR TTTGTCCCTCCTGATGACGG AGG (reversed) Intergenic
No off target data available for this crispr