ID: 986672737

View in Genome Browser
Species Human (GRCh38)
Location 5:10157332-10157354
Sequence TTCACTGCTCAGAGATGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986672737_986672743 18 Left 986672737 5:10157332-10157354 CCCAAGCATCTCTGAGCAGTGAA No data
Right 986672743 5:10157373-10157395 ACCTTCCTGGAAACCTTCTCTGG No data
986672737_986672739 -7 Left 986672737 5:10157332-10157354 CCCAAGCATCTCTGAGCAGTGAA No data
Right 986672739 5:10157348-10157370 CAGTGAATGTTGAAGTCCCACGG No data
986672737_986672745 22 Left 986672737 5:10157332-10157354 CCCAAGCATCTCTGAGCAGTGAA No data
Right 986672745 5:10157377-10157399 TCCTGGAAACCTTCTCTGGAAGG No data
986672737_986672740 5 Left 986672737 5:10157332-10157354 CCCAAGCATCTCTGAGCAGTGAA No data
Right 986672740 5:10157360-10157382 AAGTCCCACGGCAACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986672737 Original CRISPR TTCACTGCTCAGAGATGCTT GGG (reversed) Intergenic
No off target data available for this crispr