ID: 986674551

View in Genome Browser
Species Human (GRCh38)
Location 5:10171610-10171632
Sequence GGTCTGAGAGGTCCATAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986674551_986674558 19 Left 986674551 5:10171610-10171632 CCTGCCTATGGACCTCTCAGACC No data
Right 986674558 5:10171652-10171674 GAACCCCTGCCTTTAATTAGAGG No data
986674551_986674554 -8 Left 986674551 5:10171610-10171632 CCTGCCTATGGACCTCTCAGACC No data
Right 986674554 5:10171625-10171647 CTCAGACCTCCATGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986674551 Original CRISPR GGTCTGAGAGGTCCATAGGC AGG (reversed) Intergenic
No off target data available for this crispr