ID: 986681294

View in Genome Browser
Species Human (GRCh38)
Location 5:10235179-10235201
Sequence CACTTTCCTGCTCTCTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 599}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986681294_986681296 -5 Left 986681294 5:10235179-10235201 CCCAAACAGAGAGCAGGAAAGTG 0: 1
1: 0
2: 0
3: 39
4: 599
Right 986681296 5:10235197-10235219 AAGTGCATACTCACCATCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986681294 Original CRISPR CACTTTCCTGCTCTCTGTTT GGG (reversed) Intronic
900510317 1:3056346-3056368 CACCTTCCTGCTCTCTATTCAGG - Intergenic
900750615 1:4394795-4394817 CCCTTTCATGATCTGTGTTTTGG + Intergenic
903687444 1:25142322-25142344 CTCTTTCCAGCTCTGTGGTTTGG - Intergenic
905308972 1:37036639-37036661 CACTTTCATGCTAGCTTTTTTGG - Intergenic
906100389 1:43256699-43256721 CACTTTACTCCTCTTTGGTTTGG - Intronic
907489845 1:54801741-54801763 CACCTCCCTCCTCTCTTTTTGGG + Intergenic
910082066 1:83353546-83353568 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
910710040 1:90169861-90169883 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
910842570 1:91574362-91574384 CACTTTCTTGATCTCTAGTTCGG + Intergenic
910915379 1:92282507-92282529 CTCTTTCCTGCTTTCTTTTGTGG - Intronic
911281872 1:95939917-95939939 CTCTTCCCTACTCTCTGCTTGGG + Intergenic
911827622 1:102507291-102507313 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
911899456 1:103484345-103484367 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
912896666 1:113599102-113599124 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
915011783 1:152693902-152693924 GTCTTTCCTGCTTTCTCTTTTGG - Intergenic
915192591 1:154164161-154164183 CACTTTCCTACTCTTTTTTTGGG + Intronic
915711628 1:157904863-157904885 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
916543581 1:165781149-165781171 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
916589012 1:166172267-166172289 CAGTTTCCTATTCTCTGTTTTGG + Intergenic
917111518 1:171553576-171553598 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
917413080 1:174780373-174780395 CGCTTGCCTGCTTTCTGTCTGGG + Intronic
917893485 1:179463227-179463249 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
918079915 1:181198623-181198645 ATCTTTCCTGCTTTCTTTTTTGG - Intergenic
918324751 1:183398944-183398966 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
919261594 1:195202516-195202538 CAGTTTGCTGATCTCTGCTTTGG + Intergenic
920305785 1:205017238-205017260 CTCCTTGCTGCTCTCTGGTTTGG + Exonic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
921339335 1:214118849-214118871 CACTTTCAGGCTCTCAGATTTGG - Intergenic
921817129 1:219576694-219576716 CACTTCCTGGCTCTCTGTCTAGG - Intergenic
921964083 1:221069284-221069306 CACTTTCCAGCTGGCTGGTTTGG + Intergenic
922768906 1:228171428-228171450 CACTTTCCAGCTCTCTGTGCCGG - Intronic
923835288 1:237604454-237604476 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
923853728 1:237823562-237823584 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
924368876 1:243325680-243325702 CACTTTCTAGGTCTCTGATTTGG + Intronic
1062935347 10:1381798-1381820 CACCATGCTGCTCTCTGCTTCGG - Intronic
1063919158 10:10914526-10914548 CACTTGTCTGCTATCTTTTTCGG + Intergenic
1064294191 10:14063496-14063518 CACTTTCCAGCTCTTTAATTTGG - Intronic
1065119082 10:22511226-22511248 CTCTTTCCTGCTTTCTTTTGTGG + Intergenic
1065187355 10:23181305-23181327 CACTTTCCTTCTTTCCTTTTAGG - Intergenic
1066578615 10:36854533-36854555 CACCATTCTACTCTCTGTTTCGG + Intergenic
1066993205 10:42536829-42536851 GTCTTTCCTGCTTTCTGTTGTGG + Intergenic
1067191895 10:44077867-44077889 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1067193626 10:44093945-44093967 AACTTTCCTGCTTTCTCTTACGG - Intergenic
1067436772 10:46284246-46284268 CTTTTTCCTTCTCTCTCTTTCGG - Intergenic
1067533522 10:47091822-47091844 CACTTTCCTACTCCCTGCATTGG + Intergenic
1068256500 10:54518094-54518116 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1068355347 10:55902535-55902557 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1068394617 10:56445188-56445210 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1068413454 10:56686835-56686857 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1068426377 10:56870519-56870541 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1070153656 10:73820227-73820249 CTCTGTCCTGCTCTTTGATTGGG - Intronic
1070366322 10:75740616-75740638 CAGTTTCCGCCTCTCTGTGTAGG - Intronic
1070720018 10:78749890-78749912 CACTTTCATATTCTCTGTTGGGG + Intergenic
1070946798 10:80398875-80398897 CAATTTCCTTCTCACTTTTTTGG - Intergenic
1071190365 10:83092222-83092244 CTCTTTCCTGCTTTCTCTTGCGG - Intergenic
1071450902 10:85790715-85790737 CACCTCCCTGCTCTATGATTGGG + Intronic
1071486396 10:86105307-86105329 CAGTTTCCTGGTCTCTGTGGTGG - Intronic
1071816371 10:89235713-89235735 CACCTCCTTGTTCTCTGTTTTGG - Intronic
1073077069 10:100830796-100830818 CACCTCTCTGTTCTCTGTTTAGG + Intergenic
1073193900 10:101672542-101672564 CTTTTGCCTGCTCTCTGTTTAGG - Intronic
1074000776 10:109370265-109370287 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1074015404 10:109529206-109529228 TACTTTCCTCCTCCCTGTGTTGG + Intergenic
1074621889 10:115134071-115134093 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1074648213 10:115488833-115488855 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1076158926 10:128226680-128226702 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1077600211 11:3569440-3569462 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
1077764842 11:5147231-5147253 TACTTACCTGCTCTCTGCCTTGG + Intergenic
1077857816 11:6146543-6146565 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1077861823 11:6188244-6188266 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1078403934 11:11052135-11052157 TACTTTGCTGCTCTGTTTTTTGG + Intergenic
1078557082 11:12337562-12337584 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1079006227 11:16793279-16793301 GACATTCCTGCTGTTTGTTTTGG + Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1080446513 11:32342856-32342878 CTCCTGCCTCCTCTCTGTTTGGG + Intergenic
1081056462 11:38415659-38415681 CATTCTCTTGCTCTCTGTTAGGG - Intergenic
1082122055 11:48390085-48390107 GTCTTTCCTGCTTTCTGTTGTGG + Intergenic
1082314245 11:50697463-50697485 AACTTTCCTGCTTTCTTTTATGG - Intergenic
1083230671 11:61316502-61316524 CACTTTGGTGCTCTCTTTTGTGG - Exonic
1084256123 11:67944054-67944076 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
1084776132 11:71377113-71377135 CACTTTGCTGCACTCTATGTGGG - Intergenic
1084816634 11:71651245-71651267 CACTTCCCTGTCCTCTGTCTGGG - Intergenic
1085347166 11:75775726-75775748 AACTTGTCTTCTCTCTGTTTCGG + Intronic
1085492152 11:76930574-76930596 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1086142573 11:83515632-83515654 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1086393170 11:86386929-86386951 CACTCTCTTGCTTTCTTTTTTGG + Intronic
1087911077 11:103754006-103754028 CATTTTCCTTCTCATTGTTTTGG - Intergenic
1089361273 11:117888396-117888418 CACTCTCCCACTCTCTCTTTGGG + Intergenic
1089610155 11:119664458-119664480 CACCTGCCTGCCCTCTGTGTAGG - Exonic
1091050723 11:132367938-132367960 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1091759917 12:3080159-3080181 CTCTTTCCAACTCTCTGTTTTGG + Intronic
1091801056 12:3324689-3324711 CACTTCCCAGTTCTCTGTTCCGG + Intergenic
1092426356 12:8378800-8378822 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
1093324287 12:17755126-17755148 AACTTTCCTGCTTTCTGATGTGG + Intergenic
1094289080 12:28825938-28825960 CTCTTTCTTACTCTCTCTTTTGG - Intergenic
1094861075 12:34467162-34467184 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1095217474 12:39566739-39566761 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1095395920 12:41762266-41762288 CAGTTTCCCTCTCTCTGCTTGGG - Intergenic
1095798746 12:46249368-46249390 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1095830697 12:46583408-46583430 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1095904180 12:47360585-47360607 CACTCTCCTGCTCTCTGGAAAGG - Intergenic
1096168130 12:49442582-49442604 TCCTTTCCTGCTGTCTTTTTTGG + Intronic
1096885632 12:54716469-54716491 CAACTTCCCACTCTCTGTTTTGG - Intergenic
1097749844 12:63339895-63339917 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1099041258 12:77656991-77657013 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1099211600 12:79797314-79797336 CATTTTCTTGTTCTCTGGTTCGG + Exonic
1100404416 12:94260979-94261001 TACTTTCCCTCTCTCTGTTCTGG - Intronic
1101768407 12:107725141-107725163 ATCTTTCCTGCTTTCTGTTTTGG - Intergenic
1104153432 12:126107189-126107211 CACTGTCATCCTCTCTGTTTTGG - Intergenic
1104472413 12:129040662-129040684 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1104862679 12:131932366-131932388 CACTTTCCAGCTCAGTGTTCTGG + Intronic
1106812899 13:33377740-33377762 CACCTTCCTGCTCTAAGTGTAGG - Intergenic
1107370619 13:39743136-39743158 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1107611617 13:42119067-42119089 CACTTTAATGTTCTGTGTTTGGG + Intronic
1108392232 13:49957748-49957770 CACTTTCCAGGTCTCCTTTTTGG + Intergenic
1108414441 13:50183409-50183431 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1110221056 13:73074126-73074148 CACTTTCATGTCGTCTGTTTTGG + Intronic
1110422321 13:75326480-75326502 CACTTTTGAGCTCTGTGTTTTGG - Intronic
1110578002 13:77082719-77082741 CATTTTCCCTCTCTCTTTTTGGG + Intronic
1111506345 13:89194654-89194676 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1111830759 13:93326038-93326060 CAGCTTCCAGGTCTCTGTTTAGG + Intronic
1112096230 13:96135334-96135356 AACTCTACTGCTCTCTGTTATGG + Intronic
1112325999 13:98443244-98443266 CACTCTCCTGCTCTCTACTAGGG - Intronic
1112985251 13:105441194-105441216 CACTTTCCCACTCCCTGTCTGGG + Intergenic
1114011168 14:18370104-18370126 ATCTTTCCAGCTTTCTGTTTTGG + Intergenic
1114033993 14:18603983-18604005 CTCTCTCCTTCTCTCTCTTTGGG - Intergenic
1114036522 14:18634874-18634896 CACTTTCCGCCTCTCTTTATTGG - Intergenic
1114078788 14:19183156-19183178 CTCTCTCCTTCTCTCTCTTTGGG - Intergenic
1114124652 14:19711028-19711050 CTCTCTCCTTCTCTCTCTTTGGG + Intergenic
1114390195 14:22299441-22299463 AACTTTCCCCTTCTCTGTTTTGG - Intergenic
1114962831 14:27916253-27916275 TATTTTCCTGCTTACTGTTTTGG - Intergenic
1114993279 14:28315623-28315645 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1115007813 14:28508235-28508257 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1115013764 14:28584769-28584791 CCCTTTCATGCTCTCTCTTTTGG + Intergenic
1115276771 14:31618383-31618405 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1115360407 14:32494053-32494075 CACTTTGGTGTTCTCTCTTTTGG + Intronic
1115477343 14:33828477-33828499 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1117739898 14:58806504-58806526 CACTTTCCTTCTCTCTTGCTTGG + Intergenic
1117842288 14:59871591-59871613 CACTTTCCTCCTCTGAGTTTGGG - Intergenic
1117883958 14:60340038-60340060 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1118076775 14:62308172-62308194 TACTTGCCTTTTCTCTGTTTGGG + Intergenic
1118958394 14:70504325-70504347 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1119140435 14:72262604-72262626 CTCTTTCTTCCTCTCTGTTATGG - Intronic
1119482091 14:74964280-74964302 CCCTTTCCTGCTCCCTCTGTGGG - Intergenic
1119990077 14:79186727-79186749 CACTTCCCAGCTGTCTCTTTTGG + Intronic
1121537396 14:94700168-94700190 CGCGTTCTTGCTCTTTGTTTTGG - Intergenic
1122278177 14:100605870-100605892 CATTTACTTGGTCTCTGTTTGGG + Intergenic
1122524517 14:102371310-102371332 CACTGTCCTGCGCTAGGTTTGGG - Intronic
1122695078 14:103548501-103548523 CAGTTTCCTGATCTCTTTCTGGG + Intergenic
1123210816 14:106758797-106758819 CACTGTAGTGCTCTCTGTTTGGG + Intergenic
1123398519 15:19961119-19961141 CACTGTGGTGCTCTCTGATTTGG + Intergenic
1123510881 15:20998564-20998586 CTCTCTCCTTCTCTCTCTTTGGG + Intergenic
1123604210 15:22007645-22007667 CTCTCTCCTTCTCTCTCTTTGGG + Intergenic
1124510756 15:30322433-30322455 GACTCTCCTGCTCTCTGTGATGG - Intergenic
1124732132 15:32208102-32208124 GACTCTCCTGCTCTCTGTGATGG + Intergenic
1125218462 15:37306384-37306406 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1125276772 15:38001636-38001658 CAATTTCTTGCTTTTTGTTTTGG + Intergenic
1125310794 15:38376270-38376292 CTCTTTCCTGTTCTGTGCTTTGG + Intergenic
1126083963 15:44993152-44993174 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1126884824 15:53138555-53138577 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1126911803 15:53425132-53425154 TACTTTCCCCCTCTCTGATTGGG - Intergenic
1127248949 15:57209324-57209346 AATTTTCCTGCTTTCTGTTTTGG - Intronic
1128504913 15:68261393-68261415 TACTGCCCTGCTCTCTGTCTGGG + Intergenic
1128857208 15:71029054-71029076 ATCTTTCCAGCTTTCTGTTTTGG + Intronic
1130943906 15:88536331-88536353 CAGTTCCCTGCTCTCTGGTATGG - Exonic
1131137715 15:89951158-89951180 CAGTTCCCTGCTCTCTGGTATGG + Intergenic
1131985761 15:98041735-98041757 CTCTTTACTGCTCTATGTCTGGG + Intergenic
1202976460 15_KI270727v1_random:299411-299433 CTCTCTCCTTCTCTCTCTTTGGG + Intergenic
1133371968 16:5252131-5252153 CACTTCCCTGTCCTCTGTCTGGG - Intergenic
1133432243 16:5747983-5748005 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1133807821 16:9138744-9138766 CATTGTCCTGCTCCCTTTTTAGG + Intergenic
1135790589 16:25390813-25390835 CCCTTCCCTGCTCTCTTTCTTGG + Intergenic
1136779735 16:32889585-32889607 CACTGTAGTGCTCTCTGTTTGGG - Intergenic
1136890878 16:33971933-33971955 CACTGTAGTGCTCTCTGTTTGGG + Intergenic
1137083484 16:36095031-36095053 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1137561313 16:49504048-49504070 CACTTTCCATCTCTATGATTTGG - Intronic
1139483323 16:67242676-67242698 CACTTCTCTGGTCTCTGTCTTGG + Intronic
1140321002 16:73951689-73951711 AGCTTTCCTGCTCCCTGTCTTGG + Intergenic
1140590727 16:76349151-76349173 AACTCTCCTTCTCTCTCTTTTGG + Intronic
1140792425 16:78404825-78404847 CACTTTACTGCCCTGTGTTCTGG - Intronic
1140956252 16:79869150-79869172 CACTTTCTTGCTTTCTTTTAAGG - Intergenic
1140963166 16:79936894-79936916 CACCTTCTTGTTCTCTGTTTGGG + Intergenic
1141631585 16:85290935-85290957 CACTTCCCTGCTCCCTGCTTGGG - Intergenic
1142302232 16:89265445-89265467 CACTCACCTGCTCTGTGCTTTGG + Intergenic
1203082155 16_KI270728v1_random:1151673-1151695 CACTGTAGTGCTCTCTGTTTGGG - Intergenic
1143046160 17:4081560-4081582 AACCTTTCTGCGCTCTGTTTTGG - Intronic
1143599807 17:7937208-7937230 CACTTTCCTGCTCACGATTCAGG - Exonic
1143727948 17:8862808-8862830 CACTTTCCCGCTGCCTATTTTGG - Intronic
1144572852 17:16410761-16410783 CACTTTACAGTTCCCTGTTTTGG + Intergenic
1145213143 17:21030555-21030577 CACTTGCCTGCTCTGTGGTGGGG - Intronic
1145882549 17:28363095-28363117 TACTTATTTGCTCTCTGTTTGGG - Exonic
1146094529 17:29916337-29916359 CACTTAACTGCTCTATGCTTTGG - Intronic
1146145227 17:30409965-30409987 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1148540491 17:48476669-48476691 CACTTACTAGCTCTCTGTTTGGG - Intergenic
1148853846 17:50567888-50567910 CTCTCTCCTGCTTGCTGTTTTGG + Intronic
1149212468 17:54319398-54319420 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1149679270 17:58493816-58493838 CACTTTCCTTCCTTCTGTTAAGG - Intronic
1151382725 17:73736703-73736725 CACTTCCCTGTTCTCTCTCTGGG + Intergenic
1151971920 17:77462083-77462105 CCCTTTCCTTCTATCGGTTTTGG + Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1154061030 18:11060290-11060312 AACTTTCCTGCTTTCTCTTGTGG - Intronic
1154414205 18:14165682-14165704 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1154477613 18:14778972-14778994 CACTTTTTTTCTCTTTGTTTAGG - Intronic
1154482171 18:14841574-14841596 CACTTTCTTTCTCTTTGATTAGG - Intronic
1155243985 18:23889922-23889944 CAATCTCTAGCTCTCTGTTTGGG - Intronic
1156186026 18:34664627-34664649 CACCTTCCACCTGTCTGTTTAGG - Intronic
1156252288 18:35362259-35362281 CACTTGCCTGCTTTTGGTTTAGG - Intergenic
1156497515 18:37535865-37535887 ACCTTTCCTGGTCTCTTTTTGGG + Intronic
1156573171 18:38281796-38281818 AATTTTCTTGATCTCTGTTTTGG - Intergenic
1156597539 18:38564691-38564713 CATTTTCCTCCACACTGTTTGGG + Intergenic
1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG + Intergenic
1158074667 18:53514334-53514356 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1158114206 18:53976883-53976905 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1161010451 19:1957236-1957258 CACTGGCCTGCTCTCCGTGTAGG - Intronic
1165663802 19:37608050-37608072 GACATTCCTGATCTCTGGTTTGG + Intronic
1165779693 19:38425374-38425396 CACTTAACTGCTCTGTGTCTCGG - Intronic
1167312614 19:48745910-48745932 CGTTCTCCTGCTCTCGGTTTGGG - Exonic
1168170273 19:54582885-54582907 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1168201606 19:54819420-54819442 CTCTTTCCTGCTGTCTATGTGGG - Intronic
1168206408 19:54853453-54853475 CTCTTTCCTGCTGTCTATGTGGG - Intronic
925009354 2:470540-470562 TCCTTTCCTGATATCTGTTTGGG - Intergenic
925321203 2:2970533-2970555 CACTTTCTAGCTCTGTGATTTGG + Intergenic
925507028 2:4578072-4578094 CACTTACCAGCTTTCTGATTTGG + Intergenic
925747902 2:7059750-7059772 CACTTTCCTTCTCAGTGCTTTGG + Intronic
926269663 2:11355703-11355725 CTCTTTCCAGCTCTCCCTTTGGG - Intergenic
926457038 2:13079869-13079891 CACTCTACTTCTCTCTTTTTGGG - Intergenic
926943348 2:18161440-18161462 CACTTTCCTGGCCTGGGTTTAGG + Intronic
927336755 2:21933443-21933465 TACTCTCCTTCTCTCGGTTTTGG + Intergenic
928450792 2:31377236-31377258 CACCTTCCTGATCTCTTTTAGGG - Exonic
928754461 2:34507632-34507654 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG + Intergenic
929786521 2:44997300-44997322 GTCTTTCCTGGTCTCTGGTTTGG + Intergenic
930264440 2:49183612-49183634 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
930465162 2:51738306-51738328 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
930493186 2:52103118-52103140 CAGTTTCCTTTTCTATGTTTTGG + Intergenic
930648946 2:53944725-53944747 CATTTTCCAGACCTCTGTTTGGG - Intronic
931178470 2:59876449-59876471 CACCTCCCTGATCTCTCTTTGGG + Intergenic
932328264 2:70878934-70878956 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
932868432 2:75371992-75372014 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
932899796 2:75684511-75684533 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
933197744 2:79411409-79411431 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
933355966 2:81209327-81209349 AACTTTCCTGCTCTCTCTGGTGG - Intergenic
933556854 2:83840858-83840880 TACTTACCTTCTCTGTGTTTTGG - Intergenic
933603459 2:84356848-84356870 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
933898463 2:86832664-86832686 CAATTTACTGCTCCCTGTGTGGG + Intronic
934773063 2:96920204-96920226 CACTTTCCTTCTCCCACTTTTGG - Intronic
934912050 2:98267572-98267594 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
935020597 2:99227020-99227042 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
935117999 2:100154767-100154789 CTCTTTCCTGCTTTCTTTTGTGG + Intergenic
936235584 2:110739823-110739845 CACTTGCCTGTTCACTGTCTAGG + Intronic
936553725 2:113474597-113474619 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
936621164 2:114099406-114099428 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
936762382 2:115802539-115802561 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
936914509 2:117626147-117626169 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
936929157 2:117769121-117769143 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
936930283 2:117781189-117781211 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
936932739 2:117806680-117806702 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
936939995 2:117874437-117874459 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
936942395 2:117899000-117899022 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
936967338 2:118140103-118140125 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
937481794 2:122269182-122269204 CACTTTCCTCTGCTCTGTGTGGG - Intergenic
937990220 2:127658072-127658094 CTCTTGCCTGCTCTGTGTTTGGG - Intronic
938083196 2:128381102-128381124 CACTTTCCGGTTCTGTGTCTGGG - Intergenic
939344561 2:140947011-140947033 CACATTCCTTCTCTCCATTTTGG - Intronic
939478660 2:142719310-142719332 CACTTTCCTTATGTCTTTTTAGG - Intergenic
939522291 2:143246181-143246203 CACTTGGCCGCTCTCTGCTTGGG + Intronic
939775904 2:146387802-146387824 AGGTTTCCTGCTCTGTGTTTAGG - Intergenic
940085442 2:149853340-149853362 AACTTTCCTGCTTTCTCTTGCGG - Intergenic
940881024 2:158947007-158947029 CTCTTTCTTGCTCTATCTTTTGG + Intergenic
941593164 2:167444973-167444995 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
942277182 2:174331893-174331915 AATTTTCGTGCTCTCTGTCTGGG + Intergenic
944923082 2:204435778-204435800 CATTTTCCAGCTCTATGTCTTGG + Intergenic
945100668 2:206259788-206259810 TCCTTTCCTGCTGCCTGTTTTGG + Intergenic
945191107 2:207188418-207188440 TACTTTCCTCCTGTCTGTTGAGG + Intergenic
945612300 2:212019093-212019115 CTCTTTGCTGCTCTGTGCTTCGG - Intronic
945816539 2:214611666-214611688 CCATTTCCTGACCTCTGTTTTGG + Intergenic
945959452 2:216117044-216117066 CACTTCCCTGTTCTCTGCATGGG + Intronic
1169295073 20:4388571-4388593 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1170799452 20:19579011-19579033 GCCTTTCCTGCTCTCTAATTGGG + Intronic
1173240931 20:41296652-41296674 CTCTACCCTGCTCTCTGTCTTGG + Intronic
1173328487 20:42054698-42054720 CACATTCCTTCTCTCTCTTTGGG + Intergenic
1173770713 20:45654464-45654486 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1174175216 20:48640311-48640333 CACTTTCCCACTCTGTGTGTGGG - Intronic
1174242872 20:49152280-49152302 CATTTCCCTGCTCTCTGTTGGGG - Intronic
1175143368 20:56877402-56877424 CTCTCTGCTTCTCTCTGTTTTGG + Intergenic
1175338182 20:58210087-58210109 CACTTTCCACCCCTCTGTCTTGG - Intergenic
1175561814 20:59937220-59937242 AACTGTCTTGCTCTCTGTTTTGG + Exonic
1176319418 21:5295500-5295522 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1176421020 21:6515350-6515372 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
1176745210 21:10645861-10645883 CACTGTGGTGCTCTCTGATTTGG + Intergenic
1176798432 21:13395050-13395072 CACTTTCTTTCTCTTTGATTAGG + Intergenic
1176858826 21:13992566-13992588 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1177365320 21:20127872-20127894 ATCTTTCCTGCTTTCTGTTGCGG + Intergenic
1178590925 21:33909277-33909299 CACTTTCTTTCTTTCTTTTTTGG + Intronic
1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG + Intronic
1179217275 21:39378383-39378405 CAGACTCCTGCTCTTTGTTTTGG + Intergenic
1179404933 21:41117576-41117598 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1179696511 21:43123669-43123691 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
1179942190 21:44647499-44647521 CACTTTCCTCCCCACTGTCTGGG + Exonic
1180042923 21:45289067-45289089 CACTTCCCTGCTCGATGTATGGG + Intergenic
1180435662 22:15300908-15300930 AACTTTCCAGCTTTCTGTTGTGG + Intergenic
1180458112 22:15531025-15531047 CTCTCTCCTTCTCTCTCTTTGGG - Intergenic
1180460647 22:15561931-15561953 CACTTTCCGCCTCTCTTTATTGG - Intergenic
1181301133 22:21882134-21882156 CACTGCCCTCCTCTCTGTGTTGG + Intergenic
1181470584 22:23136914-23136936 CTCTTTCCTGCTCTGTGATCTGG - Intronic
1181644638 22:24224783-24224805 CAATACCCTGCTCTCTGTCTTGG + Intronic
1182113268 22:27739519-27739541 CATTTTCCTGCTCCCTTTTGTGG + Intergenic
1182167853 22:28194315-28194337 AACTTTCCTGCTTTCTCTTGTGG - Intronic
1182169459 22:28212159-28212181 AACTTTCCTGCTTTCTCTTGTGG - Intronic
1182870586 22:33643429-33643451 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1183642538 22:39101203-39101225 CCCCTCCCTTCTCTCTGTTTGGG + Intronic
1184205278 22:42998446-42998468 CCTTTTCTTGCTCTGTGTTTTGG - Intronic
1184609746 22:45595134-45595156 CATTTTCCTGGGCTCTGGTTTGG - Intronic
950180625 3:10910710-10910732 CACTTTCCAGCTGTGTGGTTTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950486609 3:13277767-13277789 CTCTTTTCTGATCTCTGATTTGG - Intergenic
951070922 3:18328390-18328412 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
951572709 3:24082056-24082078 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
951962613 3:28346381-28346403 GAATTCCCTTCTCTCTGTTTAGG - Intronic
953210943 3:40874636-40874658 CACTTTACTGTTCTGTGTGTTGG - Intergenic
953254931 3:41280691-41280713 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
954323490 3:49848079-49848101 CACATTCCTGCTCTCTGCTAAGG + Intronic
954488697 3:50880164-50880186 AACTTTCCTGCTTTCTCTTGTGG - Intronic
955163473 3:56487837-56487859 CTCTTTCCTGCTGAGTGTTTTGG + Intergenic
955251865 3:57291016-57291038 CACTTTCCTCCTCTCTAAGTAGG + Intronic
955438860 3:58933804-58933826 ATCTTTCCTGCTTTCTTTTTGGG - Intronic
956926419 3:73993731-73993753 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
957071036 3:75568091-75568113 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
957727785 3:84089641-84089663 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
958184897 3:90108090-90108112 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
958512122 3:95062913-95062935 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
958805473 3:98804652-98804674 AACTTTCCTGCTTTCTCTTGTGG + Intronic
959207006 3:103321857-103321879 CATTTTCCTATACTCTGTTTTGG + Intergenic
959285490 3:104403511-104403533 CAAATTCCTGCTCTTTCTTTAGG - Intergenic
959764614 3:110010695-110010717 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
959979377 3:112498161-112498183 CACTCTACTGCACTCAGTTTGGG - Intronic
960085725 3:113589046-113589068 CACTCTTCTGCTGTCTGTCTTGG - Intronic
961283078 3:125778633-125778655 CACTTCCCTGTCCTCTGTCTGGG - Intergenic
961797584 3:129420870-129420892 CTCTGTCTTGCTCTCTTTTTTGG + Intronic
961813153 3:129533261-129533283 CAATTTCCTTCTCTGTGCTTTGG + Intronic
962476714 3:135761345-135761367 CCCTTTCCTGCTCATAGTTTAGG - Intergenic
962484096 3:135824999-135825021 GTCTTTCCTGCTTTCTCTTTTGG - Intergenic
962589670 3:136876186-136876208 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
963249540 3:143090334-143090356 CCCTTTCCTTCTCTATATTTGGG + Intergenic
963968753 3:151405231-151405253 CATTTTCATGCACTCTGCTTTGG - Intronic
963980540 3:151531716-151531738 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
964587359 3:158321183-158321205 CTCTTTCCTTCTTTATGTTTAGG + Intronic
964685837 3:159395428-159395450 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
964839360 3:160976982-160977004 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
964842074 3:161004949-161004971 GTCTTTCCTGCTTTCTGTTGTGG + Intronic
965654764 3:170972551-170972573 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
965669231 3:171129445-171129467 CACTTTCTTTTTCTCTCTTTAGG + Intronic
969014635 4:4095789-4095811 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
969031821 4:4221728-4221750 TCATTTGCTGCTCTCTGTTTTGG - Intronic
969739305 4:9012652-9012674 CACTTCCCTGTCCTCTGTCTGGG - Intergenic
969798486 4:9544165-9544187 CACTTCCCTGTCCTCTGTCTGGG - Intergenic
970065889 4:12093002-12093024 ATCTTTCCTGCTTTCTTTTTTGG - Intergenic
970096081 4:12464322-12464344 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
970278063 4:14423648-14423670 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
971675615 4:29624916-29624938 ATCTTTCCTTCTTTCTGTTTAGG + Intergenic
972178505 4:36437188-36437210 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
972368251 4:38395900-38395922 CACTTTCCAGCTGTGTGATTTGG + Intergenic
973341564 4:49010584-49010606 ATCTTTCCTGCTGTCTGTTTTGG + Intronic
973542713 4:51950603-51950625 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
973721294 4:53726569-53726591 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
973722336 4:53737668-53737690 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
974141107 4:57887909-57887931 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
974151114 4:58010362-58010384 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
974265862 4:59584910-59584932 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
975198546 4:71556175-71556197 TACTTTACTTTTCTCTGTTTAGG + Intronic
975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG + Intergenic
975549588 4:75598124-75598146 CTTTTTCCTTCTTTCTGTTTTGG + Exonic
975657450 4:76655839-76655861 CACCTTCCTTCTCTCTGCTGGGG + Intronic
975876162 4:78839427-78839449 AAATTTCCTGCTCTTTGATTTGG - Intronic
976272364 4:83243832-83243854 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
976810361 4:89093836-89093858 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
976861779 4:89674334-89674356 ATCTTTCCTGCTCTCTTTTGTGG - Intergenic
977375757 4:96201949-96201971 CACTTTCTAGAGCTCTGTTTCGG + Intergenic
977502840 4:97862979-97863001 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
977616893 4:99097044-99097066 ATCTTTCCTGCTTTCTGTTCTGG + Intergenic
978695132 4:111568150-111568172 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
978725859 4:111968549-111968571 CAGTTTCCTTCTATCTGCTTAGG + Intergenic
978857708 4:113412073-113412095 CATTTTCCTGCTGTCAGTTGAGG - Intergenic
978920453 4:114176769-114176791 AACTCTCCTTCTCTCTTTTTAGG - Intergenic
979423356 4:120533491-120533513 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
979615068 4:122733127-122733149 CATTTACCTCCTCCCTGTTTTGG + Intronic
980568073 4:134572019-134572041 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
980612291 4:135174567-135174589 CACGTTCCTCCTCTTTCTTTTGG - Intergenic
981211871 4:142116694-142116716 ACCTTTCCTGCTTTCTCTTTTGG - Intronic
981387708 4:144151017-144151039 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
981550979 4:145940492-145940514 AACTTGACTGCTCTCTGTTTTGG - Intergenic
981668444 4:147257505-147257527 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
982263925 4:153521102-153521124 CACTTTCCGGCTCTGTGATCTGG + Intronic
982362848 4:154540695-154540717 AACTTTCCTGCTTTGTCTTTAGG - Exonic
983364380 4:166767297-166767319 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
985013569 4:185608841-185608863 CACTTTCCAGCTGATTGTTTAGG + Intronic
985490618 5:176275-176297 CACGGTCCTGCTTCCTGTTTGGG + Intronic
985987285 5:3526866-3526888 CAGTTTCCTGCTCTTTGTAAAGG + Intergenic
986347850 5:6851100-6851122 CACATCCCTGCTCTCTCTTAGGG - Intergenic
986389604 5:7272373-7272395 CCCTTTGCTGCCCTCTGTTACGG + Intergenic
986477594 5:8151692-8151714 CACTTTCATGCTCTTCCTTTAGG + Intergenic
986581959 5:9274864-9274886 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
986633020 5:9793058-9793080 CACCTTCATGCTCTATGTATAGG - Intergenic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
986804026 5:11291321-11291343 GAATTTCCTTCTCACTGTTTAGG + Intronic
987021026 5:13871612-13871634 TAATTTCCTGCTCTAGGTTTTGG + Exonic
988010294 5:25473551-25473573 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
988859130 5:35259068-35259090 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
989334501 5:40299851-40299873 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
989371023 5:40708064-40708086 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
989402653 5:41025068-41025090 GATTTTCCTGCTTTCTGTTGTGG - Intronic
989622313 5:43396893-43396915 CTCTTCCTTGCTCTCTGCTTCGG - Intronic
989784904 5:45315447-45315469 AACTTTCCTGCTTTCTCTTGTGG - Intronic
990224006 5:53628987-53629009 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
990482431 5:56224370-56224392 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
991242095 5:64472104-64472126 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
991252985 5:64584501-64584523 CACTGTGCTGCTCTATGTTAGGG + Intronic
991353763 5:65747082-65747104 CAATTTCTTGCTCTGTGCTTGGG - Intronic
991451274 5:66753184-66753206 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
991522718 5:67518492-67518514 CACTTTCCTAATCTGTGATTTGG + Intergenic
992402841 5:76427392-76427414 CACTTTCATGCTCTTGGATTTGG + Intronic
993575462 5:89594123-89594145 CCCTTTCCTCATCTCAGTTTAGG - Intergenic
993826530 5:92694365-92694387 TAATTTCCTGCTCTCGATTTGGG + Intergenic
994048797 5:95339211-95339233 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
994263037 5:97682376-97682398 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
995327298 5:110905567-110905589 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995343666 5:111087992-111088014 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995777045 5:115734834-115734856 CAAATTCCTGCTCTCAGTATTGG + Intergenic
996952977 5:129150268-129150290 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
997106974 5:131031824-131031846 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
997112465 5:131090167-131090189 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
997116984 5:131136037-131136059 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
997134382 5:131310055-131310077 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
997410542 5:133687483-133687505 CTCTCTCCTCCTCTCTGTGTTGG - Intergenic
997411988 5:133697446-133697468 CACATTCATCCTCTCTGTCTTGG + Intergenic
998523981 5:142825782-142825804 AAGTTTCCTGCTCTCTGATCTGG - Intronic
1001297394 5:170507838-170507860 TCCTGTCCTTCTCTCTGTTTGGG + Intronic
1001485980 5:172119982-172120004 AGCTTTCCTCCTCTCTGCTTTGG - Intronic
1001644727 5:173271564-173271586 CATTTTCCTTTTCTCTGCTTTGG - Intergenic
1001825069 5:174737852-174737874 CATTTTCCTGCTCTTTGTAAGGG - Intergenic
1003105137 6:3209666-3209688 CACTTTCCTGCTCTCTGACCTGG + Intergenic
1003228934 6:4232023-4232045 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1003980783 6:11387955-11387977 CACTCTTCTGCTTTCTGTATGGG + Intergenic
1004206207 6:13593917-13593939 CAGTTTCATGCTCTGTGTCTCGG + Intronic
1004896680 6:20155032-20155054 CACTTTCCTGAGTTCTGTTGTGG - Intronic
1004918820 6:20357232-20357254 CATTTTCCTGCTCACTGTTGGGG - Intergenic
1005864491 6:29927509-29927531 CATTTTCCTTCTCTCTTTGTGGG - Intergenic
1006852260 6:37107329-37107351 CACTTTTCTCCTCCCTGTTTGGG + Intergenic
1007775429 6:44222219-44222241 CATCTTCCTGCCCTCTGGTTAGG + Intronic
1007978137 6:46122463-46122485 GTCTTTCCTGCTTTCTGTTGTGG - Intergenic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1009045180 6:58229704-58229726 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1009233514 6:61094704-61094726 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1010307371 6:74340891-74340913 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1010490194 6:76466517-76466539 GACTTTCCTGCTTTCTGGTAGGG + Intergenic
1011012534 6:82718227-82718249 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1011132334 6:84064396-84064418 CCCTGTCCTGCTCTGTGCTTGGG - Intronic
1011213793 6:84983074-84983096 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1011390362 6:86845624-86845646 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1011391827 6:86862571-86862593 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1011525191 6:88256639-88256661 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1011943554 6:92872225-92872247 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
1012608862 6:101191161-101191183 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1012987506 6:105890670-105890692 CCCTTTCCTCCTCCCTGCTTGGG + Intergenic
1014277503 6:119402988-119403010 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
1015133299 6:129838468-129838490 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1015337339 6:132054847-132054869 CACCTTCCTGCTTCCCGTTTCGG - Intergenic
1015456768 6:133435390-133435412 CACTTTCCTGGTCCTTGTTAAGG + Intronic
1015459571 6:133473713-133473735 CCCTTTGGGGCTCTCTGTTTTGG + Intronic
1015630285 6:135225482-135225504 CACTTTACTCCTCTGTGCTTTGG + Intergenic
1016124107 6:140378556-140378578 GAATTTCCTGTTTTCTGTTTTGG + Intergenic
1016364868 6:143305333-143305355 AACTTTCCTGCTTTCTTTTGTGG + Intronic
1016491276 6:144606299-144606321 CTCTTTCTTGCTCTCTCTTTTGG - Intronic
1018173590 6:161161006-161161028 CCCTTTCGTGCTCTGTGCTTAGG - Intronic
1020429894 7:8108030-8108052 CATTTGCGTGCTCTCAGTTTGGG + Intergenic
1020536221 7:9401871-9401893 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1021202006 7:17737716-17737738 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1021299459 7:18954897-18954919 CACTTGCCAGCTATCTCTTTGGG + Intronic
1021664225 7:22958839-22958861 CACTTTCCTTCTTGCTATTTAGG - Intronic
1022444481 7:30458600-30458622 CTCTTTCCTGCTCTATCATTTGG - Intronic
1022487023 7:30786994-30787016 CACTTACCTGCTGTATGTTTAGG + Intronic
1022994637 7:35742303-35742325 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1023254573 7:38300301-38300323 CACTTTCCTGCCTTCTCCTTGGG - Intergenic
1023439551 7:40172003-40172025 CTCTTTCCCTCTCTCTCTTTTGG + Intronic
1024666795 7:51555241-51555263 CTCTTTCCTGCTTTCTCTATGGG + Intergenic
1025033951 7:55580285-55580307 ATCTTTCCTGCTTTCTTTTTTGG + Intergenic
1025520946 7:61729246-61729268 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1025545300 7:62158807-62158829 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1026358388 7:69580056-69580078 CAATTTCCTTCTCTCTGTATGGG - Intergenic
1027580708 7:79991375-79991397 CACACTCATGCTCCCTGTTTGGG + Intergenic
1027948755 7:84784832-84784854 CAGTTTCCTCCTCTGTGCTTTGG - Intergenic
1028411287 7:90532829-90532851 CACTTTCCTGCCCATTGATTTGG + Intronic
1028629773 7:92922324-92922346 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1028886352 7:95938905-95938927 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1029073313 7:97917418-97917440 CACTTCCCTGTCCTCTGTCTGGG + Intergenic
1029242977 7:99177639-99177661 CACTTTACTGGTCTCCTTTTTGG - Intronic
1030392088 7:108940645-108940667 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1030817790 7:114057951-114057973 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1030965839 7:115992239-115992261 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1030997314 7:116374267-116374289 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1031029704 7:116721593-116721615 AACTTTCCTGCTTTCTCTTGTGG + Intronic
1031612277 7:123842105-123842127 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1032593074 7:133211206-133211228 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1033119677 7:138656511-138656533 CTTTTTCCTGCTTCCTGTTTAGG - Exonic
1033194936 7:139319664-139319686 CACGTTCCTGCTCTCTTTCTGGG + Intergenic
1033465895 7:141589188-141589210 CACTTTCCTTCTCTGAGTCTTGG + Intronic
1033985294 7:147218891-147218913 TACTTTGCTGCTCTCTTGTTAGG + Intronic
1034044893 7:147917410-147917432 CTCCTTCCAGCTCTCTGTTCTGG + Intronic
1034150377 7:148910496-148910518 CAGATTCCTGCTACCTGTTTGGG - Intergenic
1034970305 7:155414893-155414915 CCCTTTCCTGCTTCCTGTCTTGG - Intergenic
1035828966 8:2674376-2674398 CTCTGTCCTGCTGTCTGTCTCGG - Intergenic
1036889852 8:12589376-12589398 CACTTTTCTGTCCTCTGTCTGGG + Intergenic
1037694855 8:21214676-21214698 CAGTTTCCTCCTCTCTGCGTGGG + Intergenic
1039448459 8:37651225-37651247 CCCTTTCCTGCTCTGTTTCTGGG + Intergenic
1039849847 8:41355052-41355074 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1040094080 8:43426742-43426764 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1040099260 8:43483074-43483096 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1040451456 8:47551879-47551901 AACTTTCCTGCTTTCTTTTATGG + Intronic
1040704132 8:50104671-50104693 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1040736139 8:50511024-50511046 AACTTTCCTGCTTTCTCTTGTGG + Intronic
1040777979 8:51070655-51070677 CACTTTTCAGTTCTCTGTCTAGG + Intergenic
1040971988 8:53145112-53145134 AAGTTTCATGGTCTCTGTTTCGG + Intergenic
1041204055 8:55479432-55479454 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1041328957 8:56701901-56701923 GATTTTCCTGCTCTTGGTTTTGG - Intergenic
1041573874 8:59370472-59370494 AACTTGCCTGCTCCCTGTTGTGG + Intergenic
1041592539 8:59605797-59605819 CAGTTTCCTACTCTCTGGTAAGG + Intergenic
1041815616 8:61967431-61967453 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1042350420 8:67771872-67771894 CTCCTCCCTGCTCTCTGTTCTGG + Intergenic
1042526964 8:69773576-69773598 CTCATTCATTCTCTCTGTTTTGG + Intronic
1042763325 8:72294152-72294174 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1042864974 8:73349132-73349154 CACTTTCCTGCTTTTTCTCTGGG - Intergenic
1044521342 8:93202806-93202828 GTCTTTCCTGCTTTCTGTTGTGG + Intergenic
1044589758 8:93902715-93902737 CAGTTTCCTGCTCTCTATAATGG - Intronic
1044603258 8:94026564-94026586 AAGTTTCCTCCTCTCTGTTAGGG + Intergenic
1044782178 8:95754417-95754439 CAATTTCTTGCTCTCTCCTTTGG - Intergenic
1045083442 8:98653365-98653387 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1045088475 8:98713167-98713189 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1045661692 8:104444437-104444459 CACATTCCTGCTGTCTTTTTAGG - Exonic
1045794460 8:106026332-106026354 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1046218634 8:111182792-111182814 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1046290924 8:112159722-112159744 CAATTACCTGCTGTCTTTTTAGG + Intergenic
1046888990 8:119400692-119400714 CACATTCCTCCACTCTGTGTGGG - Intergenic
1046994698 8:120504809-120504831 AACTTTTCTGCTCTATGTTCTGG + Intronic
1047582105 8:126227195-126227217 TACCTTTCTGCTCTGTGTTTTGG - Intergenic
1047591347 8:126330329-126330351 CACTCTCCTGTTCTGTGTTTGGG + Intergenic
1048092220 8:131253354-131253376 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1048320956 8:133399892-133399914 CACTTTCCTGCCATCTTCTTTGG + Intergenic
1048713723 8:137243395-137243417 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1048970904 8:139644577-139644599 CACTTTCCTCATCTCTGAATTGG - Intronic
1049250714 8:141587539-141587561 CAGTTTCCTGCTCGGTGTGTGGG + Intergenic
1050329805 9:4534092-4534114 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1050356585 9:4789310-4789332 CACTTTCTTGATTTCTTTTTTGG - Intergenic
1050387277 9:5103950-5103972 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1050390280 9:5135655-5135677 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1050597562 9:7219025-7219047 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1050602086 9:7263147-7263169 CCCTTTCCTGATCTCTGGGTTGG - Intergenic
1050790922 9:9468147-9468169 CTCTTTCCTTCTTTCTGTGTAGG + Intronic
1050960329 9:11721785-11721807 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1051073254 9:13199286-13199308 CACTTTCTTGATTTCTTTTTTGG + Intronic
1051240690 9:15052472-15052494 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1052132124 9:24860819-24860841 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1052451673 9:28638928-28638950 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1052746386 9:32445722-32445744 AACTTTCCTGCTTTCTCTTGTGG + Intronic
1054596263 9:67069851-67069873 ATCTTTCCTGCTTTCTTTTTCGG + Intergenic
1055445414 9:76377474-76377496 CACTTTCATCCTCTCTGTAGGGG - Intergenic
1055706086 9:79005975-79005997 CACTTTTCTTCTCTCTTTTTTGG + Intergenic
1055961808 9:81827683-81827705 CACTTCCCAGCTCTTTGGTTTGG - Intergenic
1056541702 9:87577050-87577072 AACTTTGCTGCTCAGTGTTTGGG + Intronic
1057423267 9:94928718-94928740 CATTTTCCTGGTGACTGTTTAGG + Intronic
1057553989 9:96072989-96073011 CTCTCTCAGGCTCTCTGTTTTGG - Intergenic
1058202719 9:102064286-102064308 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1058207769 9:102129934-102129956 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1058209561 9:102150853-102150875 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1058224236 9:102340232-102340254 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1058604447 9:106705726-106705748 CCCTTTCCTCCTCTCTGTGTGGG + Intergenic
1058800211 9:108538355-108538377 CACTCTTTTGCTCTGTGTTTGGG + Intergenic
1059359218 9:113726866-113726888 CTCTTTCCTCCTCTCTTTCTTGG - Intergenic
1059599534 9:115761551-115761573 GACTTTCATGGACTCTGTTTTGG - Intergenic
1060506825 9:124204046-124204068 AACGTTCCTGCTCTCTGTCACGG - Intergenic
1061580791 9:131534611-131534633 CTCTTACCTGCTCTCTGGTGCGG + Intergenic
1062171331 9:135136445-135136467 CACTGCCCTGCTCTCTGCTTGGG - Intergenic
1186082744 X:5951430-5951452 CTCTTTCCTGCTCTCTCTGCTGG + Intronic
1186228164 X:7423722-7423744 CACTTGCTTTCTCTCTTTTTAGG - Intergenic
1186866714 X:13727632-13727654 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1186886425 X:13918770-13918792 CACCTCCCTGCTCTCTCTCTTGG - Intronic
1186892926 X:13977710-13977732 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1187596081 X:20774194-20774216 GATTTTCCTGCTTTCTCTTTTGG - Intergenic
1188219538 X:27524638-27524660 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1188227226 X:27614561-27614583 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1188742701 X:33805890-33805912 CAGTTTTCTGCTTTTTGTTTAGG + Intergenic
1190615405 X:52224994-52225016 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1190721022 X:53148000-53148022 AACTTTCCTGCTTTCTCTTGTGG - Intergenic
1190929936 X:54939276-54939298 ATCTTTCCTGCTTTCTGTTGTGG - Intronic
1190941874 X:55049916-55049938 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1190945022 X:55084028-55084050 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1191145456 X:57160968-57160990 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1191606431 X:63067369-63067391 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1191711608 X:64155195-64155217 AACTTTCCTGCTTTCTTTTGTGG - Intergenic
1192160073 X:68778716-68778738 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1193050295 X:77092287-77092309 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1193146293 X:78079472-78079494 ATCTTTCCTGCTTTCTCTTTTGG + Intronic
1193180442 X:78448695-78448717 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1193338868 X:80322462-80322484 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1193376676 X:80769625-80769647 ATCTTTCCTGCTTTCTGTTAGGG - Intronic
1194314996 X:92366601-92366623 TTCTTTCCAGCTCTCTGTTGTGG + Intronic
1194612474 X:96060924-96060946 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1194612815 X:96063941-96063963 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1194622225 X:96187538-96187560 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1194648712 X:96489437-96489459 GACTTTCCTGCTTTCTCTTGCGG - Intergenic
1195102598 X:101569864-101569886 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1195127148 X:101819707-101819729 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1195226677 X:102802314-102802336 ATCTTTCCTGCTTTCTGTTGTGG + Intergenic
1195417265 X:104633952-104633974 GTCTTTCCTGCTTTCTCTTTTGG + Intronic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1196643889 X:118095961-118095983 ATCTTTCCTGCTTTCTCTTTTGG - Intronic
1196985290 X:121263272-121263294 CACCATTCTACTCTCTGTTTTGG + Intergenic
1197185070 X:123576824-123576846 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1197447184 X:126564779-126564801 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1197990981 X:132316982-132317004 CACTTTCCTGCTTTCTCTTGTGG + Intergenic
1198172423 X:134120194-134120216 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1198335539 X:135662623-135662645 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1199138254 X:144278881-144278903 CTCTTTCTTGGTCTCTTTTTGGG - Intergenic
1199483974 X:148328575-148328597 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1199705156 X:150418546-150418568 ATCTTTCCTGCTTTCTGTTGTGG + Intronic
1199713112 X:150486270-150486292 CATTCTCCTGCTCTCTGAATGGG - Intronic
1199856507 X:151763134-151763156 CAGTTTCCTGCTGTCTGTGAAGG + Intergenic
1200405667 Y:2808708-2808730 AACTTTCCTGCTTTCTCTTGTGG + Intergenic
1200623046 Y:5478127-5478149 ATCTTTCCAGCTCTCTGTTGTGG + Intronic
1200859508 Y:7975325-7975347 CACTCTCCTGCCCTGTGTGTAGG + Intergenic
1200873043 Y:8123959-8123981 CACTTTCCTCCCATCTGTCTTGG - Intergenic
1201250914 Y:12056834-12056856 CAGTTTCCTGGTCTCTGCTCAGG + Intergenic
1201306480 Y:12555069-12555091 TACTTTCCTAGTCTCTGGTTTGG + Intergenic
1201333215 Y:12850594-12850616 AACTTTCCTGCTTTCTCTTGTGG + Intronic
1201520143 Y:14864118-14864140 ATCTTTCCTGCTTTCTGTTGTGG - Intergenic
1201753114 Y:17455873-17455895 ATCTTTCCTGCTTTCTCTTTTGG - Intergenic
1201848438 Y:18450110-18450132 ATCTTTCCTGCTTTCTCTTTTGG + Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic
1202577435 Y:26342558-26342580 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic