ID: 986682200

View in Genome Browser
Species Human (GRCh38)
Location 5:10244173-10244195
Sequence TCTTATTTGGGCATGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 5, 2: 43, 3: 91, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986682196_986682200 21 Left 986682196 5:10244129-10244151 CCAGTGCAGCAGTAGGAAAACAC 0: 1
1: 0
2: 0
3: 19
4: 227
Right 986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG 0: 1
1: 5
2: 43
3: 91
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986682200 Original CRISPR TCTTATTTGGGCATGGCTTG TGG Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
905958243 1:42018396-42018418 TGATATTTGTGAATGGCTTGAGG + Intronic
906196257 1:43932403-43932425 TCTGATTTGGGTCTGGGTTGAGG + Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911649653 1:100373337-100373359 TCTTATTTGGGTACAGTTTGTGG + Intronic
912410107 1:109475286-109475308 TCTCCATTGGGCATGACTTGGGG - Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913389511 1:118294973-118294995 TCTTATTAGGACAGGTCTTGTGG + Intergenic
914975893 1:152361547-152361569 TCCTATCTGGGCATTGCTTTGGG + Intergenic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
921256269 1:213342533-213342555 TCTTAATTTGTCATGGGTTGGGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922353672 1:224756399-224756421 CCTTATTTGGGCAGTGCTAGAGG - Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1063901143 10:10733594-10733616 TCATAGTTCAGCATGGCTTGGGG + Intergenic
1064836970 10:19543871-19543893 GTTTATTTGGGCCAGGCTTGAGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071151889 10:82645619-82645641 TCTTATTTTGCCATGGATTTGGG - Intronic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1074381148 10:112981792-112981814 TCTGTTTTGGTCATGGTTTGTGG + Intronic
1074948846 10:118308575-118308597 TCCTTTCTGGGCATGGGTTGTGG - Exonic
1074968508 10:118515743-118515765 CCTGATTTGGGGAAGGCTTGAGG + Intergenic
1075200059 10:120395069-120395091 TTTGCTTTGGGGATGGCTTGAGG + Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078469660 11:11576842-11576864 TCTCCTTTGGCCATGGCCTGAGG + Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1080681662 11:34482553-34482575 GCTCATTTGGGTATGACTTGAGG - Intronic
1080787011 11:35484603-35484625 ACATTTTTGGGCATGGCTTATGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1084369218 11:68727878-68727900 TCTTATATGGATGTGGCTTGTGG - Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1086318601 11:85620216-85620238 TCTTATGTGGGTATGATTTGTGG - Intronic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087064497 11:94014830-94014852 TTGTATATGAGCATGGCTTGTGG - Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087644798 11:100796267-100796289 TCTTATTTGGGTAGGGTCTGTGG - Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088348411 11:108856877-108856899 TATTATTTGGGCAAGGCTCTAGG + Intronic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090411501 11:126512828-126512850 TCTCATTTGCTCATGGTTTGGGG - Intronic
1091370497 11:135053657-135053679 TCTTTTTAGGGCAGGTCTTGTGG + Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093867081 12:24240569-24240591 TCCTATTTGGGCAAGAATTGAGG + Intergenic
1093969005 12:25357409-25357431 TCTCATTTAGGGATGGTTTGTGG - Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1094869388 12:34582253-34582275 TCATATTTGGGAGTGCCTTGAGG - Intergenic
1095168747 12:39007618-39007640 TCTTATATAGGCACGGCTTGTGG - Intergenic
1095467900 12:42506872-42506894 TGTTCTTTTGGCATAGCTTGTGG + Intronic
1095509070 12:42929518-42929540 TCTCATTTGGCAGTGGCTTGAGG + Intergenic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095729022 12:45485461-45485483 TCTTATATGGGTGTGCCTTGTGG - Intergenic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098785665 12:74751091-74751113 TCTTATGTGGGTATAGTTTGTGG - Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1101489198 12:105196294-105196316 CCTTCTTTGGGCATGGTTTGAGG - Intronic
1105387136 13:19941540-19941562 CCTTATTTGGGTATAGTTTGAGG + Intergenic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1106267863 13:28125975-28125997 TCTTATTTGGGAAAGTCTAGGGG + Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106878443 13:34102937-34102959 ACATTATTGGGCATGGCTTGAGG + Intergenic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1108760209 13:53553507-53553529 TCATAGTTCAGCATGGCTTGGGG - Intergenic
1109350466 13:61174090-61174112 TCTTATGTGGGCACAGGTTGTGG - Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110537228 13:76665574-76665596 TCTCACTTAGGCATGCCTTGAGG + Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111392674 13:87618347-87618369 TTTCATCTTGGCATGGCTTGAGG - Intergenic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114734261 14:25027401-25027423 TCATTTTTGGGCATGGTTTGTGG - Intronic
1115154669 14:30324333-30324355 TCTTATTTGGATGTGGTTTGTGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1117541382 14:56749792-56749814 TGTTCCTTGGCCATGGCTTGTGG - Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118507713 14:66432359-66432381 TCTTATTTTGGCACAACTTGTGG - Intergenic
1118512276 14:66488682-66488704 TCTTATGTGGCCATTTCTTGGGG - Intergenic
1119017294 14:71071998-71072020 TCTTATATGGGCATAAATTGTGG + Intronic
1119769387 14:77210921-77210943 TTTTCCTAGGGCATGGCTTGTGG + Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126263500 15:46724008-46724030 TTTTATTTGGGCAGGGGATGGGG + Intergenic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132538080 16:493413-493435 GCTTATTTGGTCATGCTTTGTGG + Intronic
1132854953 16:2040541-2040563 TCTGCTTTGGGCAGGGCCTGGGG + Intronic
1134772674 16:16823824-16823846 TCATATCTGGGAATGGCTTATGG + Intergenic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1137513557 16:49122913-49122935 TCTTGTTAGGGCAGAGCTTGAGG - Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1141633978 16:85304013-85304035 TCTTATCTGGGCCTCGCTTCTGG - Intergenic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1144324461 17:14165447-14165469 TCTTTTATGGGCACGGCTTATGG - Intronic
1145136479 17:20413714-20413736 TCTTATGTGAGCATAGTTTGAGG + Intergenic
1146352469 17:32106326-32106348 TCTTACTTGTGAATTGCTTGTGG + Intergenic
1147203685 17:38821659-38821681 TCTGATTTAGGTATGGCTAGTGG - Intronic
1147458659 17:40554545-40554567 TCTTTTTTTGGCATTGGTTGAGG + Exonic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149326054 17:55530829-55530851 TCTTATTTGGGAATTGTCTGCGG + Intergenic
1149433621 17:56615311-56615333 TCTTATTGGGTCATAGGTTGTGG - Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1150757579 17:67929471-67929493 TCTTACTTGTGAATTGCTTGTGG - Exonic
1153492887 18:5667801-5667823 TCTGTTATGGGCATGGCTCGTGG + Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156481145 18:37437196-37437218 TCTTTCTTGGGCATGGGGTGGGG - Intronic
1156907532 18:42371719-42371741 GTTTATTTGGGCCTAGCTTGAGG - Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1164183696 19:22842596-22842618 GTTTATTTGGGCAAAGCTTGAGG - Intergenic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
925954271 2:8946731-8946753 TCTTATGTGGGCACAGTTTGTGG - Intronic
926722283 2:15969950-15969972 CCTCATACGGGCATGGCTTGTGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
928917889 2:36492846-36492868 TCTATTTTGGGCAGGGATTGGGG - Intronic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930798788 2:55420631-55420653 TACTATTTGGGCATGGGTCGGGG + Intergenic
934869664 2:97851710-97851732 TCTTATGTGGGCATAATTTGTGG - Intronic
934974539 2:98791524-98791546 TCTTATTTGGGTATGGGGAGGGG - Intergenic
935163015 2:100545579-100545601 GTTTATTTGGGCCAGGCTTGAGG + Intergenic
935377629 2:102416162-102416184 CTTTATTTGGGCAGAGCTTGAGG - Intergenic
935615673 2:105078579-105078601 TCTTATTTGCTAATGGCTTATGG - Intronic
935990391 2:108713969-108713991 TCTTGTATGAGCATGGCTTGCGG + Intergenic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939858719 2:147392338-147392360 TCTGATTTGGGCCTGGGGTGGGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
942538901 2:176995145-176995167 TTTTATTGGGGCAGGGCTTCAGG - Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943026276 2:182633294-182633316 TTTTAATTTTGCATGGCTTGAGG - Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
946853209 2:223928044-223928066 TCTTATGTGGGCACAGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948316126 2:237029948-237029970 TCTTATATAGGCAGGGCCTGGGG + Intergenic
948655718 2:239475697-239475719 TCTCACTTGGGGATGGCCTGGGG + Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1171879471 20:30607121-30607143 CCTTATATGTGCATGTCTTGAGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173232976 20:41216200-41216222 TTTTATTTTGGAATGGGTTGAGG - Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1177850779 21:26345660-26345682 ACTTTTTTGGGCTTGGCTGGAGG + Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1181833115 22:25578957-25578979 TCTTGTTTGGGGATCTCTTGTGG - Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
949846861 3:8380404-8380426 ACTTCTATGGGCATGGGTTGAGG - Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951741373 3:25928102-25928124 TTATATGTGGGCATGGTTTGTGG + Intergenic
952671725 3:35976251-35976273 TTTTATTTGGACATTGCTTGAGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
955160312 3:56458959-56458981 TCTTTCTTGTGCCTGGCTTGAGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
955993778 3:64656867-64656889 TCCTGTTTGGGCATAGCTTTAGG - Intronic
956011783 3:64839733-64839755 TCATCTTTGGTCATGGCTGGTGG - Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963717569 3:148821530-148821552 AATTATTTGTGGATGGCTTGTGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968153586 3:196359252-196359274 TCTTGTGTGGGCGTGGTTTGTGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
972233170 4:37099012-37099034 TCTTATTTGTGTTTGGCTTTAGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975686556 4:76921594-76921616 TCGTATATGGGTGTGGCTTGTGG + Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977313594 4:95416711-95416733 TGTGATTTGGACATGGCATGTGG - Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981416401 4:144498793-144498815 ACTTATTTGGTCAAGGCTTATGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
990718007 5:58660406-58660428 TGTTGTTTCTGCATGGCTTGGGG - Intronic
990788756 5:59453170-59453192 TCTTATATAGGCATGGCTTATGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991642771 5:68771172-68771194 TGTTATTTTGGCATGGATTATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992781487 5:80132139-80132161 TATTATTTGCTCATGGTTTGGGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993270230 5:85787026-85787048 ACTTATTTGGGCATTGTTTGAGG - Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994924932 5:106102933-106102955 TTTTAATTGGATATGGCTTGGGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001011863 5:168106031-168106053 GCTTATTTGGGCTGAGCTTGAGG + Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004569322 6:16830197-16830219 TCTTCTATGGGCACGGCTGGCGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005571985 6:27154137-27154159 TTTTAATTGACCATGGCTTGTGG + Intergenic
1006981653 6:38152630-38152652 TTTTTTTTGAGCATGGCTAGTGG + Exonic
1008916822 6:56797192-56797214 TCTTATATGGTTGTGGCTTGTGG - Intronic
1009525700 6:64742280-64742302 TCTTATATGGGTGTGGCTTATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1012918432 6:105196166-105196188 TCTTATGTGGGTGTGGCTTGTGG - Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1014561634 6:122898353-122898375 TCTTATGGAGGCATGGCTGGAGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1015192389 6:130485698-130485720 TTTTATTTGGGCAGGAGTTGAGG + Intergenic
1015337014 6:132050954-132050976 TGTTTTGTGGGCATGGTTTGTGG - Intergenic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016321975 6:142856277-142856299 TTTTCTCTGGGAATGGCTTGGGG - Intronic
1016490841 6:144600048-144600070 TCTTATATGGGTGTGGCTTGAGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017091067 6:150759527-150759549 CCTGGTTTGAGCATGGCTTGAGG + Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018656565 6:166042645-166042667 TCTTTTTTGGGAGTGGCTGGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020637984 7:10719507-10719529 TGTTTTTTAGGCATGTCTTGGGG - Intergenic
1021150839 7:17148987-17149009 TTTTTTCTGAGCATGGCTTGAGG - Intergenic
1021489506 7:21203475-21203497 TCTTATGTTGGCAGGGCTTAGGG - Intergenic
1021969489 7:25951864-25951886 TTTTATTTGGGGATGGGTGGTGG - Intergenic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022392218 7:29953082-29953104 TCATATTTGGGAATGCTTTGAGG - Intronic
1022721908 7:32949066-32949088 GTTTATTTGGGCCAGGCTTGAGG + Intergenic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023383357 7:39630469-39630491 TCGTCTTTTGGCATTGCTTGTGG + Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1025071808 7:55906189-55906211 GCTTATTTGGGCCAAGCTTGAGG - Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1028344842 7:89767042-89767064 TCTTATTTGGGCACAGCTCATGG - Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1030039304 7:105435401-105435423 TCTCCTTTGGGCATGGGGTGGGG - Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030693340 7:112557441-112557463 TCTGATTTGGGTATGGTATGTGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031332077 7:120478192-120478214 TCTTATTTGGGCTAGACTTAGGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031714478 7:125091030-125091052 TATTATTTAGGCATAGATTGTGG - Intergenic
1033538564 7:142334773-142334795 TCCTATTAGGGCATGTCTTATGG + Intergenic
1033669840 7:143481031-143481053 TCTTTTTTGGGTTTGGCTTTTGG + Intergenic
1033795276 7:144838292-144838314 TCTTATAAGGGCATGGCTGGTGG - Intergenic
1034924288 7:155108501-155108523 TCTTGTATTGCCATGGCTTGTGG - Intergenic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035962919 8:4157648-4157670 TGTTATCTGGGCATGGGGTGAGG + Intronic
1036225657 8:6955403-6955425 TCTTATGTTCCCATGGCTTGTGG - Intergenic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1038206517 8:25471824-25471846 TTTTATTTAGGCATGCCATGAGG + Intronic
1038739567 8:30205175-30205197 TTTTATTTGGGCATGGCAGGGGG - Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1040859319 8:51982931-51982953 TCTGATTTGTGCATGACTGGTGG - Intergenic
1041100153 8:54388336-54388358 TCTTATGTGGGTGTGGCTTGTGG + Intergenic
1041399308 8:57425176-57425198 TCCTATTTGGGCATGAGTTTTGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044676725 8:94736913-94736935 TATTCTTAGGGCATGTCTTGTGG + Intronic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1044989791 8:97785534-97785556 GTTTATTTGGGCCAGGCTTGAGG + Intronic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046652977 8:116859581-116859603 TATTATTTGGGCATCCTTTGTGG - Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047576963 8:126166714-126166736 TCTCATATGGGCATGGCTTATGG + Intergenic
1048660243 8:136591631-136591653 CCAGATTTGGGCATGGCATGTGG - Intergenic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1053047528 9:34932231-34932253 TGACATTTGGGCATGGCTTGGGG - Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1058495227 9:105551672-105551694 TTTAATTTGTGCATGACTTGTGG + Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1188762361 X:34048558-34048580 TCTTCTTTGGGCAGGGCTGATGG + Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192009117 X:67249427-67249449 TTCTATTTCGGTATGGCTTGAGG - Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192694062 X:73395915-73395937 CATTATTTGTGCAAGGCTTGAGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193850018 X:86525782-86525804 TCTCATTTGGGGATGGTTTGAGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194326333 X:92522387-92522409 TCTTATCTAGGCCTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196067330 X:111478500-111478522 TCTTATCTGGGTGTGGCTTGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1198579061 X:138043419-138043441 ATTTATTTGGGCAGTGCTTGTGG - Intergenic
1198708554 X:139476517-139476539 GTTTATTTGGGCCAGGCTTGAGG - Intergenic
1199019174 X:142855514-142855536 TTTTATGTGGGCAAGGCCTGGGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic
1200854731 Y:7925222-7925244 TCTTCTGTGGGCAGGGCTTAAGG + Intergenic