ID: 986685111

View in Genome Browser
Species Human (GRCh38)
Location 5:10269710-10269732
Sequence GCCCATCTGGTTATTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986685106_986685111 15 Left 986685106 5:10269672-10269694 CCTGTGAGAGGCAGAATTCTAAA 0: 1
1: 0
2: 10
3: 47
4: 273
Right 986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
986685103_986685111 24 Left 986685103 5:10269663-10269685 CCCTCACCTCCTGTGAGAGGCAG No data
Right 986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
986685104_986685111 23 Left 986685104 5:10269664-10269686 CCTCACCTCCTGTGAGAGGCAGA No data
Right 986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
986685105_986685111 18 Left 986685105 5:10269669-10269691 CCTCCTGTGAGAGGCAGAATTCT 0: 1
1: 0
2: 4
3: 33
4: 226
Right 986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
986685107_986685111 -8 Left 986685107 5:10269695-10269717 CCTGTGCTCCCAAGAGCCCATCT 0: 1
1: 0
2: 1
3: 18
4: 187
Right 986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986685111 Original CRISPR GCCCATCTGGTTATTCCTTC AGG Intergenic
900989516 1:6091901-6091923 GCTCCTGTGGTTATTCTTTCAGG - Intronic
913442742 1:118916173-118916195 GCACATCTGCTTCTTTCTTCTGG - Intronic
916202923 1:162288851-162288873 CCCCATCTTGTTCTTCCTTTGGG + Intronic
917119787 1:171635338-171635360 AACCATCAGGTAATTCCTTCAGG - Intergenic
1063310532 10:4948022-4948044 GCCAATGTGATTATTCCCTCTGG + Intronic
1067541638 10:47159306-47159328 GCCCATCTGGGCATTCCCTGTGG - Intergenic
1074689208 10:115989252-115989274 GCCCATTTGTTTATTCTTCCAGG - Intergenic
1075289481 10:121216012-121216034 GCCCAGTTGGTTCTTTCTTCAGG - Intergenic
1083286111 11:61660116-61660138 GCCCAACTGGTTATTTCTTGAGG - Intergenic
1086804812 11:91227189-91227211 GCCCATCTGGTTTCTCCTACTGG + Intergenic
1087882598 11:103435723-103435745 GTTCATCTTGTTATTCTTTCAGG + Intronic
1097012219 12:55961350-55961372 GCCCATCTGGCAATACCTTTTGG + Exonic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1102749042 12:115276202-115276224 GCCCATAGGGTTATTCCCTGTGG + Intergenic
1105586508 13:21749730-21749752 ACCAGTCTGTTTATTCCTTCTGG + Intergenic
1106255049 13:28014715-28014737 GCCCATCTGATTTCTCCTTTCGG - Intronic
1107664374 13:42673869-42673891 GCCTTACTGGTTATTGCTTCTGG - Intergenic
1108576462 13:51795698-51795720 TCCTCTCTGGTTCTTCCTTCTGG - Intronic
1115315072 14:32016715-32016737 TGCCATCTGGTTGTGCCTTCAGG - Intronic
1116293723 14:43076207-43076229 GTTCATCAGGTTATTGCTTCTGG - Intergenic
1116312842 14:43347465-43347487 GCTGTTCTGGTTATTCCTGCAGG - Intergenic
1116597423 14:46868520-46868542 GCCCCTCTGGCTTTTCCTTGGGG - Intronic
1119178896 14:72590829-72590851 GCCCTTCTGGTCTTTTCTTCTGG - Intergenic
1119491547 14:75038300-75038322 GACCAGCTGGTTAATCATTCAGG + Intronic
1126871623 15:52995242-52995264 GCAGATCTGGCTATTCCTTGGGG + Intergenic
1129172221 15:73815142-73815164 GGCCCTCTGGTTATGCCCTCTGG + Intergenic
1129830206 15:78664158-78664180 GCACATCTGATTATTTCTTCAGG - Intronic
1130093480 15:80839777-80839799 TCCCAGGTGGTCATTCCTTCTGG + Intronic
1136120612 16:28131003-28131025 GCCCAGGTGGTCTTTCCTTCAGG - Intronic
1136715735 16:32279646-32279668 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136752176 16:32650121-32650143 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1136822417 16:33330341-33330363 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136828980 16:33386880-33386902 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136834046 16:33485662-33485684 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136899120 16:34016014-34016036 ACCCATCTGCTTCTTCCTGCAGG - Intergenic
1136902345 16:34051895-34051917 ACCCATCTGCTTCTTCCTGCAGG - Intergenic
1140631419 16:76856979-76857001 CCCCAGCTGGTTTTTCCTACAGG - Intergenic
1203010870 16_KI270728v1_random:238858-238880 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1203054319 16_KI270728v1_random:910105-910127 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1143947129 17:10603333-10603355 GCTCATGTGGTTCTACCTTCTGG - Intergenic
1144777456 17:17791933-17791955 GCCCATCTGGTTATGATTTTAGG - Intronic
1153526208 18:5997355-5997377 GCCCATCAGGAAATTCCTTGTGG + Intronic
1153675798 18:7454882-7454904 GCCTCTCTGGCTATTCTTTCAGG + Intergenic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1156762686 18:40612537-40612559 GTCCATTTGGTTATTCTTGCAGG - Intergenic
1157618843 18:49003615-49003637 GCCCAACTGGGGAATCCTTCAGG - Intergenic
1159272980 18:66176762-66176784 TCCCATTTATTTATTCCTTCTGG + Intergenic
1161293824 19:3509403-3509425 CTCCGTCTGGTTCTTCCTTCAGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164432014 19:28197114-28197136 GCACAGCTGGTCATTCCTTGAGG - Intergenic
1165660489 19:37575608-37575630 TGCCATCTGGTTCTTACTTCAGG + Intronic
1166820189 19:45574451-45574473 GCCCATCTGGTTGCTACTACAGG - Intronic
1167882698 19:52474736-52474758 GCCCATCTTGTAATTCATACTGG - Intronic
933750799 2:85601242-85601264 GCCCCTTTGGTTACTGCTTCAGG - Intronic
935207480 2:100909067-100909089 AGCCATTTGGTTATTTCTTCTGG + Intronic
938584130 2:132671685-132671707 GCCAATTTATTTATTCCTTCTGG + Intergenic
941699180 2:168585737-168585759 GAGCTTCTGGTTCTTCCTTCTGG - Intronic
941739616 2:169019960-169019982 TCCCTTCTGGATACTCCTTCTGG - Intronic
942139291 2:172961324-172961346 GCCCATTTTGTAATGCCTTCAGG + Intronic
943599652 2:189900235-189900257 GCCCATTTGTTTGTTTCTTCGGG + Intronic
944903990 2:204244337-204244359 GCCCTTTTGTTTCTTCCTTCTGG - Intergenic
947062365 2:226181202-226181224 ATCCATATGGTTATTCCTTAAGG - Intergenic
947924973 2:233913413-233913435 TCCCATCAGGTCATTGCTTCTGG + Intergenic
948292118 2:236833374-236833396 CCCCATCTAGTGATTCCTGCTGG - Intergenic
1170734656 20:19004421-19004443 GCCCATATGGTTATTCTCCCTGG + Intergenic
1172523263 20:35582780-35582802 GCCCAACTTGTTAGTCCATCAGG - Intergenic
1174094288 20:48075675-48075697 GCCCATCTGGTTTATCCACCAGG + Intergenic
1180890966 22:19288761-19288783 GCCCCTCTGCTTTTTCATTCAGG - Intronic
1181577030 22:23801728-23801750 GCCCTTCTGGTTAATCTCTCAGG + Intronic
1183169598 22:36177168-36177190 TGGCATCTGGTTCTTCCTTCAGG + Intergenic
1183646598 22:39130744-39130766 GGGCATTTGATTATTCCTTCTGG - Intronic
1183733590 22:39631396-39631418 GCCCATCTGGCTCTTGCTCCAGG + Intronic
1183960685 22:41410249-41410271 GCCCATCTGTTTACTTCTGCAGG + Intergenic
1203289059 22_KI270735v1_random:16956-16978 GCCCATTTGCTTCTTCCTGCAGG + Intergenic
949722504 3:7007023-7007045 GCTAATTTGGTTATTACTTCTGG + Intronic
949878324 3:8641627-8641649 GCCCATCTGGTCTTTCCCACAGG - Intronic
950047341 3:9956866-9956888 GTACTTCTGGTTATTTCTTCTGG + Intergenic
950391798 3:12702623-12702645 TCACATCTGGTCATCCCTTCAGG - Intergenic
954739166 3:52733412-52733434 GCCCATCTTGTAATCCATTCTGG + Intronic
954739848 3:52740151-52740173 GCCCATCTGGTTATTTTTGATGG - Intronic
964170837 3:153768135-153768157 GCCCACCTGGCTATACCCTCAGG + Intergenic
968522373 4:1039846-1039868 GCCAATGTGGTTGTTCCTGCCGG + Intergenic
969633287 4:8350962-8350984 GCCCACCAAGTGATTCCTTCTGG + Intergenic
970030172 4:11665364-11665386 GAACATCTGTTTTTTCCTTCAGG - Intergenic
971551847 4:27967148-27967170 GCACAGCTGGTTATTCATTCTGG + Intergenic
981430692 4:144655663-144655685 ATCCATCTGTTTATTCCTTCTGG - Intronic
986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG + Intergenic
987277469 5:16376875-16376897 TCCCATCAGGATATTCCTTTTGG - Intergenic
988303660 5:29466857-29466879 GCTCATCTGGTTTTCCTTTCCGG - Intergenic
988481976 5:31639020-31639042 GCCCACCTTGTTATTCCTGCAGG + Intergenic
989666015 5:43854798-43854820 GCCCAGTTGGTTAATCTTTCAGG + Intergenic
993477994 5:88388706-88388728 GCCCATGTGGTTTCTCCTTAGGG - Intergenic
998185434 5:139975546-139975568 GCCCATAGGGTTACTCCTGCAGG - Intronic
999945156 5:156587742-156587764 GCCCAAGTGTTCATTCCTTCAGG + Intronic
1002432462 5:179211391-179211413 GCCCACCTGGGTATGACTTCTGG - Intronic
1017303780 6:152892778-152892800 GCCCATCTCCTAATACCTTCAGG + Intergenic
1017310023 6:152965575-152965597 GACCATATGGTTATTCTCTCTGG - Intergenic
1017471473 6:154740997-154741019 GAACATCTGGTTATTACTTTGGG + Intronic
1022122148 7:27319284-27319306 GCCGTTCTGTTTTTTCCTTCAGG + Intergenic
1023569985 7:41561731-41561753 GCCCCTCTGATTGTTCCTTCAGG + Intergenic
1025300910 7:57819280-57819302 GCACATCTGGTTATTCAGGCAGG - Intergenic
1033655155 7:143368265-143368287 TCCCATCTGGTTCTTCTCTCTGG - Intergenic
1034223780 7:149466629-149466651 GCCAATCTGGTTATTTCCTCTGG + Intergenic
1043163636 8:76875733-76875755 TACCATGTGGTTTTTCCTTCTGG + Intergenic
1047947083 8:129891132-129891154 GCCTATGGGGTTCTTCCTTCAGG + Intronic
1052324854 9:27206578-27206600 GCACAGCTGGTTCTTCCCTCTGG - Exonic
1055709894 9:79049514-79049536 GCCCATCTGCATCTTCGTTCCGG + Intergenic
1058165323 9:101612332-101612354 GGCCATCTAGTTACTCATTCTGG - Intronic
1061948590 9:133922478-133922500 GCCCATCAGGTGATGGCTTCTGG + Intronic
1187380201 X:18794753-18794775 GCCCATCAGCTTGCTCCTTCTGG + Intronic
1187478338 X:19631590-19631612 GCCTTTTGGGTTATTCCTTCTGG + Intronic
1189242048 X:39532891-39532913 GGCCATCTGGTTATCATTTCAGG - Intergenic
1189380607 X:40499989-40500011 ACCCTTCTCCTTATTCCTTCAGG + Intergenic
1198910280 X:141606056-141606078 GTCCATTTTGTTATTTCTTCAGG - Intronic
1202019984 Y:20454087-20454109 GCCCATCTGCTTCTTCCCTTAGG + Intergenic