ID: 986685776

View in Genome Browser
Species Human (GRCh38)
Location 5:10274175-10274197
Sequence CTCGGCCTCTCCCATGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986685767_986685776 6 Left 986685767 5:10274146-10274168 CCAATTCCCCTTCAGCTGATGCC No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685764_986685776 18 Left 986685764 5:10274134-10274156 CCAATCCCGTCACCAATTCCCCT No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685770_986685776 -1 Left 986685770 5:10274153-10274175 CCCTTCAGCTGATGCCCAGGTCC No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685765_986685776 13 Left 986685765 5:10274139-10274161 CCCGTCACCAATTCCCCTTCAGC No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685766_986685776 12 Left 986685766 5:10274140-10274162 CCGTCACCAATTCCCCTTCAGCT No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685769_986685776 0 Left 986685769 5:10274152-10274174 CCCCTTCAGCTGATGCCCAGGTC No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data
986685771_986685776 -2 Left 986685771 5:10274154-10274176 CCTTCAGCTGATGCCCAGGTCCT No data
Right 986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986685776 Original CRISPR CTCGGCCTCTCCCATGACAC AGG Intergenic
No off target data available for this crispr