ID: 986686337

View in Genome Browser
Species Human (GRCh38)
Location 5:10278387-10278409
Sequence ATGTGGGTGTGGGGGTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 604}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986686337 Original CRISPR ATGTGGGTGTGGGGGTCAGT GGG (reversed) Intronic
900319254 1:2074426-2074448 TTGTGGGTCTGTGGGTCTGTCGG + Intronic
900388260 1:2420369-2420391 AGGTGGGTGTGGGGGCCTGTGGG + Intergenic
900554598 1:3273438-3273460 ATGTGTGTGTGTGGGTGGGTGGG + Intronic
900602638 1:3509650-3509672 GTGTGGGGGTTGGGGACAGTGGG - Intronic
900848185 1:5120635-5120657 AGGTGGGTGTGGAGGTGGGTAGG - Intergenic
900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG + Intergenic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902359848 1:15936304-15936326 ATGTGCTTGTGGGGCTCAGCAGG + Intronic
903541167 1:24097155-24097177 ATGGGGCAGTGGGGGTCAGGTGG + Intronic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
903866060 1:26398702-26398724 ATGGGGGTGTGGGGGGCAGGGGG + Intergenic
904408718 1:30311956-30311978 AGGTGGGTGAGGGGCTGAGTGGG + Intergenic
904528877 1:31155195-31155217 TTGGGGGTGTGGGGGTCTGGCGG + Intergenic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
904895079 1:33811116-33811138 GTCGGGGTGTGGGGGTAAGTGGG - Intronic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905798904 1:40831020-40831042 AGCTGGGGGTGGGGGTGAGTGGG - Intronic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
906288270 1:44602648-44602670 ATGTGTGTGTGGGGTGGAGTCGG - Intronic
908002898 1:59698435-59698457 ATGGGGGTGTGGGGGTTGGAGGG - Intronic
908264761 1:62367414-62367436 GGGTGGGTGTTGGGGTCATTTGG - Intergenic
909012256 1:70347825-70347847 ACCTGGGTGTGGGGGTGATTTGG - Intronic
909308778 1:74118566-74118588 ATGTGTGTGTGGGAGGTAGTGGG - Intronic
909590948 1:77348740-77348762 GTGTGGGTGTGTGGGTGTGTGGG - Intronic
909982945 1:82126065-82126087 ATGTGTGTGTGTGGGTGTGTGGG - Intergenic
910159633 1:84259331-84259353 GGGTGGGAGTGGAGGTCAGTTGG + Intergenic
910327866 1:86030580-86030602 ACGTGGGTTTGAGGGTCTGTTGG - Intronic
910739397 1:90498323-90498345 ATGTGGGCCTGGTGGTTAGTTGG + Intergenic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
912184867 1:107263212-107263234 GTGTGGGTGTGAGAGTGAGTGGG + Intronic
912658482 1:111508183-111508205 GTGTGGGTGGGGGGGTCTGGTGG - Intronic
913483016 1:119307347-119307369 GTGTGTGTGTGTGTGTCAGTTGG - Intergenic
914427486 1:147591318-147591340 ATGTATGTGTTGGGATCAGTGGG - Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
914952871 1:152132454-152132476 ACGCTGGTGTGTGGGTCAGTGGG - Intergenic
915216722 1:154345328-154345350 ACATTGGTGTGGGGATCAGTGGG + Exonic
915283346 1:154837632-154837654 AAGTGGGTCTGGGGGTCCCTGGG + Intronic
915316445 1:155031498-155031520 GTGGGAATGTGGGGGTCAGTTGG - Intronic
915490247 1:156246645-156246667 ATGGGGGTTGGTGGGTCAGTGGG + Intronic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915738452 1:158099497-158099519 GGGTGTGTGTGGGGGTTAGTGGG + Intronic
916174431 1:162025698-162025720 AAGTGGGCGTGGGAGTCAGGAGG + Intergenic
916911402 1:169351051-169351073 ATGTGGGTGTGGGTGTGTATTGG - Intronic
917443138 1:175084275-175084297 ATTTGGGTGTTGGGGACAGGAGG + Intronic
918072107 1:181140782-181140804 ATGTGTGTGTGTGTGTTAGTGGG + Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
919690995 1:200528267-200528289 ATGTGGGTGGGGGGTTGAGGTGG + Intergenic
919962461 1:202485405-202485427 ATGTGAGGGTGGGGGGCAGGGGG + Intronic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920108756 1:203572604-203572626 GTGTGGGTGTGTGGCTCTGTGGG - Intergenic
920232692 1:204481069-204481091 ATGTGTGTGTGGGGTGCAGGGGG - Intronic
920958377 1:210640669-210640691 GTGCGTGTGTGGGGGGCAGTGGG - Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
921277935 1:213537705-213537727 ATGTGGGTGTGTGAGTTTGTGGG + Intergenic
921448801 1:215278449-215278471 AGGTGGGAGTGAGGGTGAGTGGG + Intergenic
922227112 1:223655018-223655040 GTGTGGGTGTGTGGGTGTGTGGG + Intronic
922291166 1:224210088-224210110 CTGTGGGTCTTGGGGTCTGTGGG - Intergenic
922477207 1:225914795-225914817 ACCTGGTTGTGGGGGGCAGTGGG - Intronic
922555947 1:226532015-226532037 GTGTGTGTGCAGGGGTCAGTGGG + Intergenic
922717205 1:227883929-227883951 ATGGGGGTCCGGGGGTCCGTCGG - Intergenic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
923015038 1:230120161-230120183 GGGTGGGGGTGGGGGTGAGTGGG + Intronic
923132870 1:231092444-231092466 ATGGGGGTGGGGGGGGCGGTGGG + Intergenic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
923862627 1:237906661-237906683 ATGAACGTGTGGGTGTCAGTTGG + Intergenic
923920540 1:238559645-238559667 GTGTGGGTGTGGGGATTAATAGG + Intergenic
924009262 1:239646701-239646723 ATGTGGGTGTGTGGGTTATGAGG + Intronic
924821338 1:247493550-247493572 ATGTGGGTTGGGGGGTGAGGTGG + Intergenic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1063057431 10:2521090-2521112 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057455 10:2521202-2521224 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057467 10:2521258-2521280 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057624 10:2521866-2521888 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057967 10:2523252-2523274 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057974 10:2523280-2523302 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057986 10:2523330-2523352 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057993 10:2523358-2523380 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1064859848 10:19815815-19815837 AGGTGGGTGTGGGGCGCAGTTGG + Intergenic
1066518399 10:36189205-36189227 ATGAGGATGTGTGTGTCAGTGGG - Intergenic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1067083303 10:43225238-43225260 GTCTGTGTGTGGGGGTCTGTGGG + Intronic
1067410598 10:46060863-46060885 AAGAGGGTGTGGGGGACAGAGGG - Intergenic
1067561620 10:47308630-47308652 AAGTGTGTGTGGGGGACACTGGG - Intronic
1067768433 10:49107121-49107143 ATGAGTGAGTGGGGGTGAGTGGG - Intronic
1068056845 10:52021606-52021628 ATGTGTGTGTGGTAGACAGTAGG + Intronic
1068568317 10:58599940-58599962 GTGTGTGTGTGTGTGTCAGTGGG + Intronic
1069717899 10:70532594-70532616 AGGGAGGTGTGGGGGTCAGAGGG - Intronic
1069844230 10:71359607-71359629 ATGTGGGTGAGTGGGTGTGTGGG - Intronic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070497465 10:77037680-77037702 ATGTTGGTGAGGGTGTCAGCAGG - Intronic
1070949316 10:80418444-80418466 AGGTGGGGGTGGGAGTGAGTTGG - Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071858975 10:89653490-89653512 GTGTGGGTTTTGTGGTCAGTGGG + Intergenic
1072451574 10:95543183-95543205 ATGTGGGTTGGGGGGTGAGCTGG - Intronic
1073453177 10:103621535-103621557 CTGTGAGGGTGGGGGTCACTGGG + Intronic
1073485149 10:103812552-103812574 ATGTGTGTGTCGGGGTCAGTAGG - Intronic
1073505339 10:103982868-103982890 GTCTGGCTGTGGGGGCCAGTTGG + Intronic
1074580888 10:114718336-114718358 ACGTGTGTGTGGGGGTGGGTGGG - Intergenic
1075074993 10:119344789-119344811 ATGTGCGTGTGGGGTGCAGAGGG + Intronic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1076024457 10:127100519-127100541 GTGTGGGTGTTGGGCTCAGGAGG + Intronic
1076984193 11:223601-223623 ATGGGGGTGTGGGGGCGAGGTGG - Intronic
1077080440 11:722506-722528 ATGTCGCTGTGGGAGTCACTGGG + Exonic
1077171739 11:1169364-1169386 AGGTGGGTGAGTGGGTGAGTGGG - Intronic
1077171763 11:1169524-1169546 AGGTGGGTGAGTGGGTGAGTGGG - Intronic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077365563 11:2160176-2160198 ATGTGGGCGTTGGGGCCTGTAGG - Intronic
1077436492 11:2541887-2541909 AAGGGGGTTTGGGGGCCAGTCGG + Intronic
1077772030 11:5229707-5229729 GTGTGTGTGTTGTGGTCAGTGGG - Intergenic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078771984 11:14359341-14359363 GTGTGGGAGTGGGTGTCAGTTGG + Intronic
1079480995 11:20879581-20879603 GTGTGTGTGTGGGTGTCAGGTGG + Intronic
1080446955 11:32346145-32346167 ATGCTGGTGTGGGGGTCCCTGGG - Intergenic
1080639916 11:34152632-34152654 ATTTGGGGGTGAGGGTGAGTGGG - Intronic
1081160562 11:39743374-39743396 TTGTGGCAGTGGGGGTCAGTGGG + Intergenic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081691404 11:45080903-45080925 ACCTGGGGGTGGGGGTCAGGAGG - Intergenic
1082059386 11:47847633-47847655 ATGTGTGTGTGGGGGTGGGGGGG + Intronic
1083138851 11:60704966-60704988 ATGTAGGTGTGTGAGTCAGGAGG - Intronic
1083175643 11:60948511-60948533 ATGGGGATGTGGGGGTGGGTGGG - Intronic
1083306375 11:61764122-61764144 AGCTGGGGGTGGGGGTCAGCAGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1085028967 11:73258233-73258255 ATGTGAGTATGGGGATCAGGCGG + Intergenic
1085278543 11:75315320-75315342 ATGTGGGTGTGGGGGTCAATGGG - Intronic
1085453922 11:76655257-76655279 AGGTGGGTGGGGGGGTGAGCTGG + Intergenic
1086194475 11:84120902-84120924 ATGTGGTTTTAGTGGTCAGTTGG + Intronic
1086404810 11:86490364-86490386 GTGTGCGTGTGTGTGTCAGTAGG + Intronic
1087471535 11:98581593-98581615 ATGTGTGTGTCGGTGTCTGTGGG - Intergenic
1087935947 11:104035056-104035078 AAGTGGGGGTGGGGGAGAGTAGG + Intronic
1088906734 11:114160836-114160858 AGGTGGTTTTGGGGGTCAGAAGG + Intronic
1088987125 11:114919038-114919060 AAGAGTGTGTGGGGGGCAGTGGG - Intergenic
1089098526 11:115939904-115939926 ATGTGGCTGGGGGTGTCAGCTGG + Intergenic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1089736609 11:120554077-120554099 CTGTGGGTGGGGGTGTGAGTGGG - Intronic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090488913 11:127140604-127140626 GTGTGAGTGTGGGGATGAGTGGG + Intergenic
1091150800 11:133326633-133326655 ATGTGGGTGTTGGGGAGTGTGGG + Intronic
1091196814 11:133738652-133738674 ATGTGGGTGTGTGTGTATGTGGG + Intergenic
1091196970 11:133739333-133739355 ATGTGAGTGTGGGTGTGGGTGGG + Intergenic
1091443279 12:527942-527964 GTGTGGGTGGGTGGGTGAGTAGG + Intronic
1091751452 12:3023829-3023851 ATTTGGGTGTGGGGAGGAGTAGG - Intronic
1091825838 12:3512007-3512029 TTGGGAGTGTGGGGGGCAGTGGG + Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1092670132 12:10853231-10853253 ATGTGGGTGTCGTGGCTAGTAGG - Intronic
1094008305 12:25779551-25779573 ATGTGGATGTGAGGGTCATCTGG - Intergenic
1094524685 12:31223625-31223647 ATGTGGGGGTGCGGGACAGGAGG + Intergenic
1095463791 12:42469388-42469410 ATGTGGATGGGGTGGACAGTCGG - Intronic
1095522790 12:43086705-43086727 GTGTGGGTGTAGGGGTTATTGGG + Intergenic
1095747301 12:45674085-45674107 ATGTGGAGGTGGGGTTAAGTGGG - Intergenic
1095910442 12:47420713-47420735 GTGTGTGTGTGTGTGTCAGTGGG + Intergenic
1096244627 12:49977324-49977346 TTGTGGGTGTGAGGGGCTGTGGG + Intronic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097004878 12:55908977-55908999 ATGTGGGAATGGGCGTGAGTAGG + Intronic
1097240180 12:57569697-57569719 AGGTGGGAGTGAGGGGCAGTGGG + Intronic
1098095539 12:66951484-66951506 ATGAGGTTGGAGGGGTCAGTGGG + Intergenic
1098162557 12:67659175-67659197 ATCTGGGTGTTGGGGGTAGTGGG + Exonic
1099611568 12:84878788-84878810 AGCTGGGTGTGGTGATCAGTTGG - Intronic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101033041 12:100678536-100678558 TTGTGGGTGTGGGTGTGGGTGGG - Intergenic
1101302623 12:103496771-103496793 ATGTGGGTGTGTGGGGTGGTGGG - Intergenic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1101430405 12:104622056-104622078 ATGTGCCTGTGGGGGTCACCGGG - Intronic
1101781112 12:107837015-107837037 TTGTGGGGGTGGTGTTCAGTGGG - Intergenic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1103908521 12:124339599-124339621 AGGTGGGTAGGTGGGTCAGTGGG - Intronic
1103908580 12:124339809-124339831 AGGTGGGTGTGTGGGTCAGTGGG - Intronic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104636227 12:130439487-130439509 ATGTGTGTGTGCGTGTCTGTGGG + Intronic
1105430685 13:20334534-20334556 AGGTGGGCGTGTGGGACAGTAGG - Intergenic
1106005780 13:25769159-25769181 ACGTGGGTGTGGGAATCAGTGGG + Exonic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106585566 13:31053750-31053772 GTGTCTGTGTGGGTGTCAGTGGG - Intergenic
1106626622 13:31427264-31427286 GTGTGGGTGTGGGTGTGTGTTGG - Intergenic
1106741307 13:32645972-32645994 ATGTGTGTGTGTGGGTGTGTGGG + Intronic
1106876450 13:34079049-34079071 ATGTGAGTGTGTGGGTGGGTGGG + Intergenic
1107797589 13:44068866-44068888 ATGTTGGCGTGGGTGTCTGTAGG - Intergenic
1107800509 13:44103842-44103864 ATGTGTGTGAGGGGGTATGTGGG - Intergenic
1108287153 13:48919793-48919815 AGGTGGGGTTGGGGGACAGTGGG + Intergenic
1108576585 13:51796451-51796473 ATGGAGGTGAGGGGGGCAGTAGG + Intronic
1108795805 13:54029073-54029095 ATTTGTGTGTAGGGGTAAGTAGG + Intergenic
1109266709 13:60208774-60208796 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1110620805 13:77593304-77593326 GTGTGTGTGTGTGTGTCAGTGGG + Intronic
1110840137 13:80132834-80132856 ATGTGGGTGTGAGGGGGAGGTGG - Intergenic
1111489564 13:88954185-88954207 TTGCTGGTGTGAGGGTCAGTAGG - Intergenic
1111981899 13:95025311-95025333 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
1112496783 13:99911532-99911554 ATGTGGTGGTGGGGGAGAGTAGG - Intergenic
1112553523 13:100445225-100445247 ATGGGGGTGTGTGGATCATTGGG - Intronic
1114568468 14:23649255-23649277 ATGTGTGTGTGTGGTACAGTAGG + Intergenic
1114960928 14:27888172-27888194 ATCAGGGTGTGGGGGTGAGTGGG + Intergenic
1118940158 14:70327080-70327102 ATGTCAGAGTGGTGGTCAGTAGG - Intronic
1118985623 14:70752372-70752394 ATGTGAGTGAGTGGGTCTGTGGG + Intronic
1119054349 14:71403982-71404004 ATGTGGGTGGGTGGGTGGGTGGG - Intronic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1120120353 14:80671867-80671889 ATGGGGGGGTGGGGGGTAGTGGG + Intronic
1122255051 14:100470489-100470511 ATGTGTGGGTGGGTGTGAGTGGG + Intronic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122879915 14:104686067-104686089 ATGAGGGTGGGTGGATCAGTCGG + Intergenic
1123401916 15:19995681-19995703 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1123578087 15:21693116-21693138 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1123614712 15:22135598-22135620 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1124461895 15:29899777-29899799 GTGTGGGTGAGTGGGTCGGTGGG - Intronic
1124501076 15:30226196-30226218 ATGGGGGTGTGGGGGTTAATTGG - Intergenic
1124707659 15:31978721-31978743 TGGTGGGTGAGGGGGACAGTTGG + Intergenic
1124742493 15:32312471-32312493 ATGGGGGTGTGGGGGTTAATTGG + Intergenic
1125608523 15:40955983-40956005 ATGTTGGTGTGGTGGGCAGGTGG + Exonic
1125953214 15:43771457-43771479 TTGTGGGGGTGGGGTTGAGTTGG + Exonic
1126469331 15:48990849-48990871 AGGGGGGTGGGGGGGACAGTTGG + Exonic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127674937 15:61229511-61229533 ATGTGGGTGTGGGGGCCGGCTGG - Intergenic
1128296424 15:66524427-66524449 ATGAGGGTTGGGGGTTCAGTGGG - Intronic
1129970377 15:79773183-79773205 ATGTGGGTTTGGGTGACACTGGG - Intergenic
1130126013 15:81094652-81094674 ATATATGTGTGGGTGTCAGTGGG + Intronic
1130392716 15:83473221-83473243 AGGTGGGTGGGGGGGTGGGTGGG + Intronic
1130584654 15:85171836-85171858 ATGTGGATGTGGGGGTAAACAGG - Intergenic
1131451470 15:92543920-92543942 AGGTGGGGATGGGGGTGAGTGGG - Intergenic
1131494958 15:92900164-92900186 GTGTGGGGGTGGGGGTCCTTAGG + Exonic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1131874146 15:96787006-96787028 ATGTGGGTTTTGTGATCAGTGGG - Intergenic
1132353306 15:101154017-101154039 ATGTGGGTGCAGGGGTGTGTGGG - Intergenic
1202986957 15_KI270727v1_random:427361-427383 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1132910617 16:2308832-2308854 GTGTTGGTGTGGGGGTCCCTGGG - Intronic
1132998547 16:2837217-2837239 ATTTGTGTGTGTGTGTCAGTGGG - Intronic
1132998593 16:2837598-2837620 GTGTGGGTGTGTGTGTCTGTGGG - Intronic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1133635723 16:7663175-7663197 ATGTCGGTTGGGGGGTCAGAAGG - Intronic
1134251560 16:12577892-12577914 ATTTGGGTGTGGGTGTCTTTGGG - Intergenic
1134683932 16:16145771-16145793 ATGTGTGTGTGGGGGGCTGGGGG - Intergenic
1135243783 16:20836063-20836085 GGGTGGGTGTGGGGGTAAATGGG - Intronic
1135683680 16:24480278-24480300 ATGTGTGTGTGTGTGTCTGTGGG - Intergenic
1136071726 16:27791528-27791550 ATGTGTGGGTGGGGGGCGGTGGG - Intronic
1136153782 16:28368616-28368638 GTGGGGGCGTGGGGGTTAGTGGG - Intergenic
1136209310 16:28746654-28746676 GTGGGGGCGTGGGGGTTAGTGGG + Intergenic
1137415516 16:48274661-48274683 GTGTGGGTGTGGGTGTGGGTGGG - Intronic
1138296730 16:55892248-55892270 ATGGTGGTGTGGGGGTGTGTGGG - Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1140249986 16:73287344-73287366 GTGTGGCTGTGTGGGTCGGTGGG + Intergenic
1140347279 16:74226301-74226323 ATGTGGGGGTGAGAGGCAGTGGG + Intergenic
1140376915 16:74452180-74452202 AGATGGGTGTGGGGAGCAGTGGG - Intronic
1140666591 16:77233793-77233815 ATGTGGGTGGGGGGGGCTGGGGG - Intergenic
1141028363 16:80568539-80568561 AGGTGGGGGTGTGGGTGAGTGGG - Intergenic
1141028783 16:80570685-80570707 AGGTGGGGGTGGGGTTGAGTGGG - Intergenic
1141570417 16:84930516-84930538 GAGTGGGTGTGGGTGTCAGTGGG + Intergenic
1141570477 16:84930772-84930794 GAGTGGGTGTGGGTGTGAGTGGG + Intergenic
1141858869 16:86703228-86703250 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1141858896 16:86703335-86703357 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1142041450 16:87897099-87897121 ACGTGGGCGTGGGGCTCAGTAGG + Intronic
1142128413 16:88421392-88421414 CTGTCGGTGTGGGTTTCAGTAGG - Intergenic
1142215683 16:88828734-88828756 AGGTGGGTGGGGAGGTCTGTGGG + Intronic
1142321571 16:89386501-89386523 ATGAGGGTGTGGGGGAAAGGGGG + Intronic
1142368843 16:89666516-89666538 AGGTGGGTGTGGTGGTGTGTAGG + Intronic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143334575 17:6162691-6162713 GTGTGTGTGTGGGGGTGGGTGGG - Intergenic
1143555318 17:7656233-7656255 AGGTGGGTGGGTGGGTCAGTGGG - Exonic
1144591882 17:16531334-16531356 GTGTGTGTGTGGGGGTGGGTGGG - Intergenic
1144630853 17:16871683-16871705 CTGTGGGTGAGGGCGTCAGTTGG + Intergenic
1144650461 17:17003792-17003814 CTGTGGGTGAGGGTGTCAATTGG - Intergenic
1144679973 17:17186832-17186854 ATGAGGCTGTGGGGGACAGCGGG - Exonic
1145740310 17:27268512-27268534 ATGGGGGAGTGAGGGACAGTTGG + Intergenic
1145925523 17:28644369-28644391 ATCTGGGTGGAGGGGTCAGTCGG - Intronic
1145979593 17:29003937-29003959 ATGTGGGTGTGAGTGTTAGGAGG - Intronic
1146589556 17:34116876-34116898 ATGTGTGTGTGTGGGTGGGTGGG + Intronic
1147354045 17:39877339-39877361 ATGAGGGTATGGGGTGCAGTGGG - Intronic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147999354 17:44378723-44378745 ATTGGGGTGTGCGGGTAAGTTGG + Intronic
1148554345 17:48569342-48569364 ATGTGAGTGTGGGAGACAGACGG - Intronic
1148784369 17:50138438-50138460 GTCTGGGTGAGGGGGTCTGTGGG + Intronic
1148981740 17:51582521-51582543 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1149440552 17:56670288-56670310 ATGTGGGTGTTGTGGCCAATGGG - Intergenic
1149482599 17:57016026-57016048 GTGTGGGTTTTGGGATCAGTGGG - Intergenic
1149657640 17:58318770-58318792 GTGGGGGCTTGGGGGTCAGTCGG - Intronic
1149999495 17:61424786-61424808 TGGTGGGTGTGGGGGTGTGTGGG + Intergenic
1150922959 17:69502695-69502717 ATGTTGATGTGGGGGGCTGTGGG + Intronic
1151212813 17:72557430-72557452 GTGTGGGTGTGTGTGTGAGTGGG - Intergenic
1151311047 17:73292593-73292615 GAGTGGGTGTGGGAGTCAGGGGG + Intronic
1151694735 17:75708561-75708583 GTGTGTGGGTGGGGGACAGTAGG - Intergenic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1152235913 17:79138630-79138652 ATGTGCGTGTGTGGGTGAGGAGG - Intronic
1152531665 17:80922687-80922709 ATGGGGGTGTGAAGGTCAGACGG - Intronic
1153245914 18:3072690-3072712 GTGTGTGTGTGGGGGGCGGTGGG + Intronic
1154193809 18:12251779-12251801 CTGAGGGTGTGGGTGTCAGGTGG + Intergenic
1154197383 18:12276594-12276616 TTGTGGGTGCTGGGGGCAGTGGG + Intronic
1155116567 18:22774122-22774144 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1155892025 18:31282018-31282040 AGGTGGGTGGAGGGGTCGGTAGG + Intergenic
1156015052 18:32537987-32538009 ATTTGTGTGTGGGGGTGAGGGGG - Intergenic
1156097085 18:33547502-33547524 ATGTGTGGGTGGGCGTAAGTAGG + Intergenic
1156261832 18:35451658-35451680 GTGTGGGATTTGGGGTCAGTGGG + Intronic
1156587320 18:38445674-38445696 ATGAGGGTGTAGGAGTCACTGGG - Intergenic
1156760890 18:40588863-40588885 ATGTGAGTGTGGGGATGAGATGG - Intergenic
1156798608 18:41079952-41079974 ATGTGGGGGGAGGGGTGAGTGGG - Intergenic
1157105941 18:44774393-44774415 GTGTGAGTGTGGGGGTGTGTGGG + Intronic
1157531553 18:48425303-48425325 ATGGGGGTGTGGGGGACCATGGG + Intergenic
1157929032 18:51800095-51800117 ATTTGTGTGTGGGGTTCATTTGG + Intergenic
1158594474 18:58804186-58804208 ATGTGAGTGTTGGTGTCACTCGG - Intergenic
1158857406 18:61556657-61556679 ATGAGGGTCTGGGAGGCAGTAGG + Intergenic
1160002965 18:75045052-75045074 ATCTGGGTGTGGGGGGGTGTGGG + Intronic
1160458473 18:79019501-79019523 ATCTGGGTTTGGGGGTAAATGGG - Intergenic
1160709966 19:547007-547029 CTGTGGCTGTGGGGCCCAGTGGG + Intronic
1160725751 19:617106-617128 ATGGGGGTGTGGGGGTTAATGGG - Exonic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1160828894 19:1093626-1093648 ATGGGGGGCTGGGGGTGAGTGGG + Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161351963 19:3798370-3798392 GGGTGGGGGTGGGGGTCACTGGG + Intronic
1161921420 19:7269021-7269043 GTGTGGGTGTGTGGGTGTGTTGG - Intronic
1162388833 19:10377498-10377520 AGGTGGGTGAGTGGGTGAGTGGG + Intronic
1162568768 19:11458610-11458632 ACCTGGGTGAGGGGGTCAGATGG + Exonic
1162656786 19:12137471-12137493 ACGTGGGTATAAGGGTCAGTGGG - Intronic
1162904578 19:13816114-13816136 ATATGGGGGTGGGGGACAGGAGG + Intronic
1162938530 19:13994170-13994192 ATGTGGATGTGGGGGTCTCTGGG - Intronic
1163010101 19:14419579-14419601 ATCTGGGTGTGGTGCTCGGTGGG + Intergenic
1163895651 19:20056605-20056627 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1164506043 19:28862338-28862360 GTGTGGGTGGTAGGGTCAGTTGG - Intergenic
1164792303 19:30997651-30997673 ATGTGTGTGTGGTTGTCAGGGGG - Intergenic
1165142067 19:33705604-33705626 ATGCGGGTGTGGGTGCCCGTGGG + Intronic
1165462608 19:35953047-35953069 AGGTGGGTGTGGGATCCAGTGGG - Intergenic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166166210 19:40991013-40991035 GTGTGGGTGTGTGGGTTTGTGGG - Intergenic
1166332550 19:42087518-42087540 GTGTGTGTGTGGGGGTGGGTAGG - Intronic
1166766251 19:45253176-45253198 GTGTGTGTGGGGGGGTCTGTCGG - Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167230431 19:48279553-48279575 ATGGGGGTGTGTGGGTGTGTGGG + Intronic
1167230435 19:48279561-48279583 GTGTGGGTGTGTGGGTGGGTGGG + Intronic
1167822355 19:51940228-51940250 ATGTGGCTGTGGAGTTCACTTGG + Exonic
1168255152 19:55161013-55161035 AGGTGGGGCTGGGGGTCGGTGGG - Intronic
924958082 2:10032-10054 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
924991865 2:319353-319375 ATGTGTGTGTGGGTGTGTGTGGG + Intergenic
926160956 2:10489003-10489025 ATGTGGGGGTGGGGGACACGGGG - Intergenic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
927659629 2:24981968-24981990 CTGTGGTTGTGGGTGTGAGTGGG - Intergenic
930280939 2:49368769-49368791 ATGTGTGAGTGGGTGGCAGTTGG - Intergenic
930283974 2:49405140-49405162 ATGTGTGTGTTGGGGCCAATGGG - Intergenic
930624918 2:53686368-53686390 AGGAGGGTGTTGGGGGCAGTGGG - Intronic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
931937384 2:67214207-67214229 ATGTGGGTGTGTATGTAAGTCGG - Intergenic
931937432 2:67214516-67214538 ATGTGGGTGTGTGTGTCTGTGGG - Intergenic
932445779 2:71780277-71780299 ATGTGGGTGAGGCGGTCACCTGG - Intergenic
932474017 2:71989833-71989855 ATTCCGGTGTGGGGGACAGTAGG - Intergenic
932486143 2:72085433-72085455 AGGTGGGTCTGGGGAACAGTGGG - Intergenic
933575525 2:84063172-84063194 TGCTGGGTGTAGGGGTCAGTGGG - Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934276197 2:91574491-91574513 AGGTGGGTGAGGGGGTCTCTTGG - Intergenic
934768633 2:96894489-96894511 ATGTGGGTGGGTGGGTGAATGGG - Intronic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
937223892 2:120357196-120357218 GTGTGTGTGTGTGTGTCAGTGGG + Intergenic
937358317 2:121212185-121212207 ATGTGTGTGTGTGTGTCTGTTGG + Intergenic
938250985 2:129815571-129815593 CTGAGGCTGTGGGGGGCAGTGGG - Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
939519141 2:143207471-143207493 ATGTGTGTGTGTGTGTCAATGGG - Intronic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940803427 2:158157618-158157640 ATGTGAAAGTGGAGGTCAGTGGG - Intergenic
941894003 2:170611489-170611511 ATGCGGGTGTTGAGGACAGTGGG + Intronic
942089430 2:172474640-172474662 ATGTGGCTGTTGGTGCCAGTTGG + Intronic
943762230 2:191622376-191622398 GTGTGGGTGTTGGGGATAGTAGG + Intergenic
944315405 2:198280312-198280334 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
945649833 2:212543363-212543385 AGATGTGTGTGGGGGTGAGTGGG - Intergenic
946372952 2:219291534-219291556 AAATGGGTGTGAGGGCCAGTGGG + Intronic
946468190 2:219931440-219931462 GTGTGGGTGGGTGGGTGAGTGGG - Intergenic
946620600 2:221558302-221558324 ATGTGGGTGTGTGTGTGTGTGGG + Intronic
947383572 2:229568671-229568693 AAGTGAGTGTGTAGGTCAGTAGG - Intronic
948789357 2:240369432-240369454 ATGTGGGTGGGGGGGCGGGTGGG - Intergenic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948813754 2:240499395-240499417 ATGTGGGGGTGGGGGTGACCAGG + Intronic
948882805 2:240869029-240869051 AGGTAGGAGTGGGGGTCACTCGG + Exonic
1168803839 20:661665-661687 ATGGGGGTTTGGGGGTGAGTTGG + Exonic
1169021249 20:2332806-2332828 TTGTGGGAGTGGGGGTGAGGTGG - Intronic
1170403246 20:16010185-16010207 ATGTGAGTGAGTGGGTCAGTTGG + Intronic
1170426986 20:16244965-16244987 ATGTTGGTGTGAAGGTCAGGAGG - Intergenic
1172093739 20:32450753-32450775 ATGGGGGTCTGGGGCTCAGCAGG - Intronic
1172276845 20:33684793-33684815 ATGGGGGTGTGGGTGGCAGCTGG - Intronic
1172791992 20:37512133-37512155 ATATGGGTGTGTGTGGCAGTGGG + Intronic
1173062630 20:39676609-39676631 GTGTGTGTGTGTGTGTCAGTTGG - Intergenic
1173095855 20:40027548-40027570 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1173409154 20:42794302-42794324 ATGGAGGTGTGGGGGTGAGAGGG - Intronic
1173416309 20:42859203-42859225 AAGTGGCTGTGAGGGTCATTTGG - Intronic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173927127 20:46789149-46789171 ATGTGAGTGTGTGGGTGTGTGGG + Intergenic
1173927148 20:46789298-46789320 ATGTGGGTGTGTGGGTGTGTAGG + Intergenic
1173927165 20:46789410-46789432 ATGTGGGCGTGTGGGTGTGTAGG + Intergenic
1174367429 20:50065018-50065040 GTGTGTGTGTGGGGGTGTGTAGG - Intergenic
1174999158 20:55607326-55607348 ATTTGAGAGTGGGAGTCAGTGGG - Intergenic
1175202362 20:57286832-57286854 ATGTCAGTGTGGGGCTAAGTTGG - Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175531518 20:59676447-59676469 AGGTGGGGGTGGGGGTGAGGAGG - Intronic
1175932206 20:62498333-62498355 GGGTGGGTGTGGGGGTGGGTGGG + Intergenic
1175940551 20:62535718-62535740 TTGAGGGGGTGGGGGTCAGGGGG + Intergenic
1176092106 20:63322774-63322796 AGGTGGGTGTCGGGGTCGGGAGG - Intronic
1176306467 21:5126158-5126180 ATGGGGGTGTGGGGGACGTTTGG - Intronic
1176388843 21:6153394-6153416 ATGTGTGTGTGGGTGTGAATGGG - Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1177792787 21:25738225-25738247 ATGTGTGTGTTGGGGGCAGGGGG - Intronic
1178363389 21:31968515-31968537 GTGTGGGTGTGGGTGTTAGGGGG - Intronic
1178598538 21:33976246-33976268 AAGGGGGTGTGGGGGTTGGTGGG + Intergenic
1178823199 21:35993533-35993555 ATGTGAGTGTGTGTGTGAGTTGG - Intronic
1179734629 21:43384854-43384876 ATGTGTGTGTGGGTGTGAATGGG + Intergenic
1179791225 21:43757103-43757125 AGGTGGGTGTGGGGCACGGTGGG + Exonic
1179850592 21:44135872-44135894 ATGGGGGTGTGGGGGACGTTTGG + Intronic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1181100598 22:20536349-20536371 AGGTGGGGGTGGGGGTGGGTGGG + Intronic
1181437097 22:22917397-22917419 ATGTGGGTGTGTGTGTAAGCCGG + Intergenic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1182134387 22:27887612-27887634 AAGTGGGTGTGGGATTGAGTGGG - Intronic
1183062234 22:35343321-35343343 GTGTGTGTGTGGGGGTGTGTAGG - Intronic
1183077884 22:35438254-35438276 ATGTGGGTGGGTGGGTGGGTGGG - Intergenic
1183078115 22:35439394-35439416 ATGTGGGTGGGTGGGTGGGTGGG - Intergenic
1183232877 22:36593776-36593798 ATGAGGCTGTGAGGGTCAGCTGG + Intronic
1183381284 22:37491729-37491751 AGGTGGGTGGGTGGGGCAGTGGG - Intronic
1184376592 22:44117359-44117381 CAGTGAGTGTGGGGGTCTGTGGG + Intronic
1184434270 22:44460562-44460584 ATGTGGGTGGGTGGATGAGTAGG - Intergenic
1184597265 22:45521679-45521701 ATGTGGCTGTGGGGGTCCTCGGG + Intronic
1184607762 22:45583978-45584000 ATGTAGGTGTGAGGGTCTTTGGG + Intronic
1184918585 22:47590083-47590105 ATGTGGGGGTGGGGGTCCTTGGG - Intergenic
1185245768 22:49771921-49771943 AGGTGGGAGTGGGGGTCTCTGGG - Intergenic
1185337856 22:50278744-50278766 ATATGGGAGTGGTGGGCAGTGGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950627066 3:14255040-14255062 ATGTGGGTGTTGGTGTCCGTGGG + Intergenic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951092215 3:18587522-18587544 ATGTTGCTGTGGGGGTCATGAGG + Intergenic
951364696 3:21767065-21767087 ATGTGTGTGTGAGGGTGGGTGGG - Intronic
951962790 3:28348416-28348438 AGCTGGGTGTGGGGGTGACTGGG + Intronic
952942584 3:38455143-38455165 ATGTGTGTTTGGGGGTATGTGGG + Intronic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
954581545 3:51705920-51705942 ATGTGCGTGTGGCAGTCCGTAGG - Intergenic
954635489 3:52068665-52068687 AGGTGGGTGGGAGGGTCTGTGGG + Intergenic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
955352701 3:58205842-58205864 ATGCGGGTTTTGGGGTGAGTTGG - Intronic
955731842 3:61995594-61995616 GTGTGGGTATGGGGGTGTGTAGG + Intronic
956232472 3:67032031-67032053 ATCTGTGTGTGGGGGTGGGTGGG - Intergenic
956849391 3:73214443-73214465 GTGTAGGTATTGGGGTCAGTTGG - Intergenic
957437933 3:80203133-80203155 GTGTGTGTGTGTGGGTGAGTGGG - Intergenic
959260364 3:104071697-104071719 CTGTGGGTGTGTGGGTGGGTGGG + Intergenic
959638281 3:108601259-108601281 GTGTGGGTGTGGGTGTGTGTTGG + Intronic
960284453 3:115811237-115811259 ATGTGGGTGTGGGTCTGAGAGGG + Intronic
960291078 3:115885623-115885645 TTGTGTGTGTGGGGGTGGGTGGG + Intronic
961041830 3:123683283-123683305 AAGTGGGGGTGGGGGTGGGTGGG + Intronic
961891959 3:130137815-130137837 AGGTAGGTGTGGGGGTCACAAGG + Intergenic
961951851 3:130757889-130757911 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951855 3:130757905-130757927 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951859 3:130757921-130757943 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951865 3:130757943-130757965 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
962254532 3:133861368-133861390 ATGTGTGTTTGGGGGTGAGGAGG + Intronic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
964211929 3:154238265-154238287 GTGTGGGTGTGCTGGTCTGTAGG + Intronic
964638547 3:158884294-158884316 ATGGAGATGTGGAGGTCAGTTGG + Intergenic
965377062 3:167938088-167938110 ATATGTGTGTGGGGGGCTGTGGG + Intergenic
965801631 3:172499727-172499749 TAGTGGCTGTGGGGGTCAGCGGG - Intergenic
967613758 3:191540040-191540062 ATGTGGGCCTGGGGGTCGGGGGG - Intergenic
967878952 3:194285684-194285706 ATGTGCGTGTGTGGATAAGTAGG + Intergenic
968194522 3:196695419-196695441 CTGTGGGTGTGGGTGTGTGTGGG - Intronic
968194539 3:196695482-196695504 GTGTGGGTGTGTGGGTGTGTGGG - Intronic
968194541 3:196695490-196695512 ATGTGGGTGTGTGGGTGTGTGGG - Intronic
968443200 4:634828-634850 ATGTGAGTGTGGGGGGCACCTGG + Exonic
968534469 4:1114116-1114138 GTGGGGGTGGGGGGGGCAGTTGG + Intergenic
969311074 4:6353503-6353525 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311135 4:6353699-6353721 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311145 4:6353731-6353753 CTGTCGGTGTGGGGGGCTGTTGG - Intronic
969311209 4:6353927-6353949 CTGTTGGTGTGGGGGGCTGTCGG - Intronic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969437306 4:7195404-7195426 TAGTGGGTGTGGGTGTCCGTGGG + Intronic
970497039 4:16636679-16636701 ATGTGGGGGTGGGGGACAAGAGG + Intronic
972284992 4:37639557-37639579 ATGTGGATGTGGGTGTGGGTTGG - Intronic
972492220 4:39598830-39598852 ATGGGGGTGTGGGGGTCACATGG - Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
972942185 4:44209532-44209554 ATGTGGGTGGGGGTGTGTGTGGG - Intronic
973332926 4:48927957-48927979 ATGTGTGTGTGTGGGTCGGGGGG - Intergenic
973629640 4:52807994-52808016 ATCTGGGTGTGGGGGTAAAGGGG + Intergenic
974975400 4:68885646-68885668 ATGGGGGTGTGGGGTTTAGGTGG + Intergenic
975172290 4:71246035-71246057 ATGTGGGTGTCATGGTTAGTTGG + Intronic
975441659 4:74418369-74418391 ATATGGGTGTGGGAGTGAGGGGG + Intergenic
975592235 4:76011589-76011611 AAGGAGGTGTTGGGGTCAGTTGG + Intronic
976795444 4:88926982-88927004 ATGTGTGTGTGTGTGTCTGTCGG - Intronic
977553783 4:98468563-98468585 ATGGGGGTGGGGGGGTGGGTGGG - Intergenic
979119523 4:116879470-116879492 ATTGGGGCATGGGGGTCAGTAGG + Intergenic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981185351 4:141795550-141795572 ACATGGGTGTTGGAGTCAGTTGG + Intergenic
981584347 4:146285079-146285101 ATGGGAGTGTAGGGGGCAGTTGG + Intronic
982822852 4:159966318-159966340 ATTTGGCTGAGGGTGTCAGTTGG + Intergenic
983661396 4:170133649-170133671 AGGTGGGAGTGGGGTTCAGGAGG + Intergenic
984057674 4:174949415-174949437 AAGTGTCTGTGGGGGTCAGGAGG + Intronic
984432219 4:179664183-179664205 ATGTGAGTGGGGGTGTGAGTGGG - Intergenic
984501767 4:180566456-180566478 GTGTGAGTGTGAGGGTGAGTGGG + Intergenic
984501926 4:180567420-180567442 GGGTGAGTGTGGGTGTCAGTGGG + Intergenic
984784348 4:183554067-183554089 ATGTGGGTGTGGGTGTGAGTGGG + Intergenic
985095154 4:186406049-186406071 ATGTGTGTGTGCGTGTGAGTGGG - Intergenic
985144226 4:186877682-186877704 ATGTGTGTGTGTGGGTGAGGGGG + Intergenic
985516114 5:345550-345572 ATGTGTGTGTGGGGATGTGTGGG + Intronic
985779109 5:1860587-1860609 CTGTGTGTGAGGGGGTCACTGGG + Intergenic
985991585 5:3566110-3566132 CTATAGGTGTGGGGGTCGGTGGG + Intergenic
986553134 5:8981253-8981275 GTGTGGGTGTGCGGGTCAGTAGG - Intergenic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
988397772 5:30716679-30716701 ATGTGGGTGTGGCTGACTGTTGG + Intergenic
988517282 5:31915960-31915982 ATGTGTGTTGGGGGGACAGTGGG + Intronic
988700714 5:33671823-33671845 ATGTGAGTGTGTGGGTGTGTGGG - Intronic
990073143 5:51809673-51809695 ATGGCTGTGTGGGGATCAGTCGG - Intergenic
990227940 5:53677510-53677532 ATATGGGGGTGGGGTACAGTAGG - Intronic
991024721 5:62017203-62017225 ATGTGGCTCTGGGGCTCTGTAGG + Intergenic
992003781 5:72459318-72459340 GTGTGAGAGTGGGAGTCAGTGGG + Intronic
992991197 5:82285375-82285397 TGTGGGGTGTGGGGGTCAGTGGG + Intronic
995379236 5:111513128-111513150 GTGTGGGTGTGGGTGTGTGTGGG + Intergenic
995626033 5:114077352-114077374 ATGTGGAAGTGTGGGTCAGTGGG + Intergenic
996117285 5:119632953-119632975 ATTTGAGTGTGGGGCTCTGTGGG + Intronic
997365413 5:133322294-133322316 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
997738917 5:136236601-136236623 ATGTGGGTGTGTGGGAAGGTTGG + Intronic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
997905122 5:137808766-137808788 TGGTGGGTGTAGAGGTCAGTGGG - Intergenic
998163285 5:139825679-139825701 GTGTGGGGGTGGTGGTGAGTGGG + Intronic
998554221 5:143107247-143107269 ATGAGGTTGGAGGGGTCAGTAGG + Intronic
999366736 5:151028295-151028317 ATGTGGGTGTGGGTGCATGTGGG + Exonic
999391490 5:151195766-151195788 TTGTGGGTGTGGGTGTGTGTGGG - Intronic
999562686 5:152821590-152821612 ATGTGTGTGTGTGGGTGTGTGGG - Intergenic
999826480 5:155278260-155278282 ATGTGTGTGTGGGTGTGTGTAGG - Intergenic
1000122009 5:158206583-158206605 ATATGGGTCTGAGGGTCAGCTGG + Intergenic
1000303794 5:159977729-159977751 GTGTGGGTGTTGGGGTGAGGAGG + Intergenic
1001051147 5:168415473-168415495 ATGTGGGTGAGGAGGTTGGTGGG - Intronic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001230283 5:169980971-169980993 GTGTGGGTGTGGTGGTCACTTGG + Intronic
1001309021 5:170597467-170597489 ATGTGTGTGCGGGGGTGGGTGGG - Intronic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1001979834 5:176030898-176030920 ATGTGAGGGTGGGGGTGTGTGGG + Intronic
1001979907 5:176031092-176031114 ATGTGAGGGTGGGGGTGTGTGGG + Intronic
1002237471 5:177812573-177812595 ATGTGAGGGTGGGGGTGTGTGGG - Intergenic
1002345987 5:178547734-178547756 GTGTGGGTGTGGGGGTGTGTGGG - Intronic
1002346018 5:178547824-178547846 GGGTGGGTGTGGGGGTGTGTAGG - Intronic
1002346027 5:178547848-178547870 GTGTGGGTGTGGGTGTGTGTAGG - Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002401004 5:178991593-178991615 AGGTGGGTGTGTGGGTGGGTGGG - Intronic
1002633337 5:180595043-180595065 GTGTGGGTGTGGGGATGTGTGGG + Intergenic
1003168679 6:3703312-3703334 TTGTGGATGTGGGGGCCAGGTGG - Intergenic
1003986210 6:11437767-11437789 TGTGGGGTGTGGGGGTCAGTGGG - Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004838344 6:19554517-19554539 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006065403 6:31457841-31457863 GTGTGGGGGTGGGAGTGAGTAGG + Intergenic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1007039650 6:38710196-38710218 ATGTGGATGTGGGGGTAAACAGG - Intergenic
1007063870 6:38969699-38969721 AGGTGTGTGTGGGGGGGAGTGGG + Intronic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1008693035 6:54002270-54002292 ATGTGGGTGTGTGGCCCAGGAGG - Intronic
1008816002 6:55567503-55567525 AGGTGGATGTGAGGGTCAGGTGG - Intronic
1009774311 6:68185668-68185690 ATGTGTGTGTGTGTGTGAGTGGG - Intergenic
1010316663 6:74459295-74459317 TCGTGGGGATGGGGGTCAGTGGG - Intergenic
1011756933 6:90509348-90509370 TTTTGTGTGTGGGGGTTAGTGGG + Intergenic
1012269581 6:97192137-97192159 ATGTGGAGGAGGGGGTAAGTAGG + Intronic
1012382313 6:98634727-98634749 ATGTGGGTGAGGCGGAGAGTCGG + Intergenic
1012779945 6:103545702-103545724 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1013369881 6:109459456-109459478 AATTGGGTGTGGGGGTCAGGTGG + Intergenic
1016405668 6:143727099-143727121 AAGGGTGTGTGGGTGTCAGTGGG - Intronic
1017041312 6:150310359-150310381 GTGGGGGTGTGGGGGTGGGTGGG + Intergenic
1017048910 6:150372370-150372392 ATGTGTGTGTGGGGGTGGGGTGG + Intronic
1017048977 6:150372686-150372708 ATGTGTGTGTGGGGGTGTGTTGG + Intronic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1018671345 6:166180040-166180062 ATCTGGGGGTGGGGGTGATTAGG - Intergenic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1018980687 6:168599497-168599519 GTGTGTGTGTGAGTGTCAGTGGG - Intronic
1019261014 7:82054-82076 GTGTGGGTGTGGGTGTGCGTGGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019553723 7:1618107-1618129 TTATGGGTGGTGGGGTCAGTGGG + Intergenic
1019704849 7:2492698-2492720 AGGTGGGTGGGTGGGTAAGTGGG - Intergenic
1019771918 7:2888679-2888701 ATTTGGGTGATGGGTTCAGTAGG - Intergenic
1021979269 7:26038778-26038800 ATGGGGGTGTGGACTTCAGTAGG - Intergenic
1022514263 7:30965415-30965437 ATGTGTGTGGGGGGGTGACTGGG + Intronic
1023177335 7:37447614-37447636 TTGTGGGTGTGTGTGTGAGTCGG - Intronic
1023258697 7:38336863-38336885 ATGGGTGTGTGGGGGTCAGGAGG + Intergenic
1023359230 7:39399131-39399153 ATCTGGGGTTAGGGGTCAGTGGG - Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863106 7:44227099-44227121 AGGTGGATGTGGGGGACAGAGGG + Intronic
1023863244 7:44227503-44227525 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863328 7:44227747-44227769 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863341 7:44227786-44227808 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1024042638 7:45567167-45567189 AAGTGGGTGTGGGGGTGGGCTGG + Intergenic
1025083601 7:56004945-56004967 GTGTCGGTGTGAGGGTCAGTGGG + Intergenic
1026271783 7:68843153-68843175 ATGTGTGGGTGTGGGTGAGTGGG - Intergenic
1027969087 7:85054519-85054541 CTGGGGGTGAGGGGATCAGTGGG + Intronic
1028035842 7:85980938-85980960 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1029116991 7:98242690-98242712 GTGTGGGTGGGTGGGTGAGTGGG - Intronic
1029452244 7:100647570-100647592 AGGTGGGGGTGGGGGTCAGGTGG - Intronic
1029643926 7:101839444-101839466 CTGTGGGTGGGGGAGTAAGTGGG - Intronic
1030112469 7:106038495-106038517 GTGTGTGTGTGGTGGTGAGTGGG + Intergenic
1031794381 7:126152779-126152801 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1032337914 7:131043396-131043418 ATATGGGAGTTGGGGTCAGGTGG + Intergenic
1032866279 7:135928315-135928337 ATGTGGGTGTGTGGGTGTATAGG - Exonic
1033022699 7:137742517-137742539 TTGTGGCTGTGGGAGTGAGTGGG - Intronic
1033082206 7:138308990-138309012 ATCTGGGGAAGGGGGTCAGTAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034423270 7:151000114-151000136 GGGTGGGTGTGGGTGTGAGTGGG + Intronic
1035259758 7:157653871-157653893 GGGTGGGTGTGGGGATCAGCGGG - Intronic
1035270784 7:157718859-157718881 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035271079 7:157720357-157720379 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035296746 7:157871792-157871814 TTGTGGGTGTGTGGGTGTGTAGG - Intronic
1035469172 7:159098668-159098690 ATGTGGGTGTGGGAGCCCCTGGG - Intronic
1036449465 8:8853186-8853208 ATGTGAGTGTGTGTGTGAGTCGG - Intronic
1036561549 8:9903778-9903800 ATGGGGGTGTGGGTGGAAGTGGG + Intergenic
1036798043 8:11769926-11769948 ACGCGGGTCTGAGGGTCAGTGGG - Exonic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037636028 8:20701603-20701625 ATGTGGGTGTTGGCGGCAGGGGG + Intergenic
1037740567 8:21605752-21605774 GTGTGGGTGTGGGTGTTTGTGGG - Intergenic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038794313 8:30696266-30696288 AAGCAGGTGTGGGGGTCATTTGG - Intronic
1039165437 8:34674396-34674418 ATGTGTGTGTGGGGGCGAGGGGG + Intergenic
1040389327 8:46936026-46936048 ATGAGTGTGGGGTGGTCAGTAGG - Intergenic
1041126931 8:54651015-54651037 ATGTGTGTGTGTGTGTCAGGGGG + Intergenic
1041447535 8:57969267-57969289 CTGTGGGTGGCGGGGTCAGCAGG + Intergenic
1042091794 8:65166571-65166593 AGTTCGGTGTGTGGGTCAGTGGG - Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1043054597 8:75421941-75421963 ATGTGTGTGTGCGCGTCAGGTGG + Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047447296 8:124930743-124930765 ATTTGGGGGTGGGGGGCAATGGG + Intergenic
1048705402 8:137147837-137147859 ATGTGGGAGTGGGAGGCATTAGG - Intergenic
1049443852 8:142621274-142621296 ATGTGAGTGTGTGTGTGAGTGGG + Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1052409484 9:28104895-28104917 TTGTGTGTGTGTGGGTCGGTGGG - Intronic
1052797448 9:32936487-32936509 CTGTGGGTGTGCGAGTCAGTTGG + Intergenic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1053360959 9:37486355-37486377 TGGTGGGTGAGGGGGTCAGCAGG - Intronic
1056218973 9:84432513-84432535 ATGTGGCTGAGAGGGTGAGTGGG + Intergenic
1056446859 9:86674768-86674790 ACATGGGTCTGGGGGTCAGCTGG - Intergenic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1056766557 9:89447774-89447796 AAGTGGTGGTGGGGGGCAGTGGG - Intronic
1056841164 9:89999020-89999042 ATTTGGGAGTGGGGTTCTGTAGG + Intergenic
1057141670 9:92730091-92730113 ATGTGGGGGTAGTGGGCAGTGGG - Intronic
1058592837 9:106583800-106583822 AGATGGGAGTGGGGGACAGTTGG - Intergenic
1059359300 9:113727887-113727909 TGGTGGGGGTGGGGGTGAGTTGG + Intergenic
1059621542 9:116011185-116011207 GTGTGGGGGTGGGGGTGGGTGGG + Intergenic
1059928594 9:119238577-119238599 ATGTGGGAGAGGGGATCAGGAGG - Intronic
1060815464 9:126632837-126632859 TTCTGGGTGTGGGGCCCAGTGGG - Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062106883 9:134760117-134760139 ATGTGAGTGTGGGGGTGTGTGGG - Intronic
1062287419 9:135779264-135779286 ATGTGGCTGTGGGGGTCTCAGGG - Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186548699 X:10479468-10479490 TTGTGGGAGTGGGGGTGGGTAGG - Intronic
1186726449 X:12364133-12364155 ATGTGTGTGTGTGTGGCAGTGGG - Intronic
1186771412 X:12821444-12821466 CTGGGGGTGGGGGGGGCAGTGGG + Intronic
1186842649 X:13499914-13499936 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1186936374 X:14454163-14454185 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187424962 X:19168992-19169014 ATGTGGGTTTGAGAGTCAGAGGG - Intergenic
1187484415 X:19688624-19688646 ATGTGGGTGTGTGTGTGGGTGGG - Intronic
1188654244 X:32670929-32670951 ATGTGTGTGTGTGTGTGAGTGGG + Intronic
1189212576 X:39296395-39296417 ATGTGGGTGTGTGTGTGTGTTGG - Intergenic
1192259297 X:69494754-69494776 ATGTGGGTGGGGGGATTAGAGGG - Intergenic
1193492238 X:82164062-82164084 ATGTGTGTGTGTGGGTGGGTGGG - Intergenic
1194382495 X:93211926-93211948 ATGTGTGTGGAGGGGGCAGTGGG - Intergenic
1195066901 X:101245326-101245348 ATCTGAGTGTGGGGGTGGGTGGG + Intronic
1195335505 X:103849287-103849309 ATGTGGGTGTGGGGGGGCGGGGG + Intergenic
1195397286 X:104425128-104425150 ATGTAGTTGTGGGTGTCACTGGG + Intergenic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1198260005 X:134957299-134957321 ATGTGACTGTGGGGGTAATTTGG - Intergenic
1199855694 X:151757141-151757163 CTGTGGGTGTAGGGGTGTGTGGG - Intergenic
1199972699 X:152872564-152872586 GTGTGTGTGTGGGGGTGTGTGGG + Intergenic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1201512205 Y:14777578-14777600 TTGGGGGTGTGGGGGAGAGTGGG + Intronic
1201535123 Y:15038809-15038831 ATATGTGTGTGGGAGTGAGTGGG - Intergenic
1202297592 Y:23376344-23376366 ATGTGAGGGTGGGGGGCAGGGGG + Intergenic
1202573217 Y:26294253-26294275 ATGTGAGGGTGGGGGGCAGGGGG - Intergenic