ID: 986690207

View in Genome Browser
Species Human (GRCh38)
Location 5:10307785-10307807
Sequence CAAGCCCGGAGGGGGCGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986690194_986690207 10 Left 986690194 5:10307752-10307774 CCAGTGGCTCCAGTCGTAGCCTC 0: 1
1: 0
2: 1
3: 9
4: 94
Right 986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 236
986690197_986690207 1 Left 986690197 5:10307761-10307783 CCAGTCGTAGCCTCCTGGGAGAG 0: 1
1: 0
2: 1
3: 12
4: 104
Right 986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 236
986690193_986690207 19 Left 986690193 5:10307743-10307765 CCTGCGGGACCAGTGGCTCCAGT 0: 1
1: 0
2: 0
3: 16
4: 141
Right 986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 236
986690198_986690207 -9 Left 986690198 5:10307771-10307793 CCTCCTGGGAGAGCCAAGCCCGG 0: 1
1: 0
2: 0
3: 22
4: 196
Right 986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986690207 Original CRISPR CAAGCCCGGAGGGGGCGGAG AGG Exonic
900315235 1:2052961-2052983 CAGGCCCACAGGGGGCGGGGTGG - Intronic
902768276 1:18631117-18631139 CGAGCCCGGAGACTGCGGAGTGG - Exonic
904039354 1:27575357-27575379 CAAGCCGGGAGGGGCGGGACTGG + Intronic
904237558 1:29124592-29124614 CGAGCCCGAAGGGGGCGGCCCGG + Intergenic
904528973 1:31155464-31155486 GAGGCCGGGAGGGGGCGCAGAGG + Intergenic
904751124 1:32741935-32741957 CATGGCAGGCGGGGGCGGAGCGG - Exonic
904956240 1:34286300-34286322 CAAGCCCAGATGGGGAGAAGAGG - Intergenic
905026967 1:34857232-34857254 CAAGCCCGGGGGGTGGGGTGGGG + Intronic
905647288 1:39633308-39633330 AAGGCCCGGAGTGGGAGGAGAGG - Intronic
906078402 1:43068387-43068409 CGGGCCGGGAGGGGGCGGCGGGG + Intergenic
906667607 1:47632503-47632525 CAAGCCCACAGGGGGAGAAGGGG + Intergenic
906689251 1:47781820-47781842 CAAGCCCAGAGAGGGCAGGGTGG - Intronic
906945852 1:50293514-50293536 CAAGCCCTGAGGGAGTGGAAGGG - Intergenic
907324207 1:53626308-53626330 CAAGACCGGAGGGAGGGGTGTGG - Intronic
909339206 1:74512656-74512678 GAAGCCAGGAGGGGGTGGTGTGG - Intronic
909628747 1:77748777-77748799 CAAGCACGGGGGGGGGGGGGAGG - Intronic
912174695 1:107141277-107141299 CCAGGCGGGAGCGGGCGGAGCGG - Intronic
912869656 1:113292339-113292361 AAAGGGCGGAGGGGGAGGAGGGG + Intergenic
913047926 1:115089499-115089521 CCGGCGGGGAGGGGGCGGAGCGG + Intronic
913449967 1:118986616-118986638 CAAGCCCGGGGAGGGGGCAGCGG - Intronic
914871004 1:151473610-151473632 CAACCCGGGAGGGAGCGGCGAGG + Intergenic
915511312 1:156388468-156388490 CAGGGCCGGAGGCGGCGGTGGGG - Intergenic
920367855 1:205457411-205457433 CAAGCCGGGTGGCGGGGGAGGGG - Intergenic
921706039 1:218323746-218323768 AAAGTCCGGAGGGGGCCAAGGGG + Intronic
922852646 1:228747157-228747179 CAGGTCCTGAGGGTGCGGAGAGG + Intergenic
924313771 1:242774545-242774567 CAAGCACGGAGCGGGCGGGCGGG + Intergenic
1063058076 10:2524010-2524032 AAAGCGAGGAGGGGGAGGAGGGG - Intergenic
1063200971 10:3785260-3785282 GGAGCCAGGCGGGGGCGGAGGGG - Exonic
1064619553 10:17201490-17201512 CGCGCCGGGAAGGGGCGGAGCGG - Intronic
1065114935 10:22476206-22476228 CACGGCCGGTGGGGGCGGGGAGG - Intergenic
1065342889 10:24723393-24723415 GGCGCCCGGCGGGGGCGGAGGGG - Intronic
1069794834 10:71045391-71045413 GAAGCCCGAAGGAGGAGGAGTGG - Intergenic
1070201241 10:74207987-74208009 AAAGTCCAGAGGGGGCTGAGGGG + Intronic
1071292044 10:84195288-84195310 CGAGCCCACCGGGGGCGGAGTGG + Intronic
1072757337 10:98030094-98030116 GGGGCCTGGAGGGGGCGGAGCGG - Intronic
1072915124 10:99533078-99533100 AAATCCCGGCGGGGGCGGGGAGG - Exonic
1076310256 10:129501229-129501251 CAAGCCCAGAGAGGGAAGAGGGG - Intronic
1076721976 10:132396859-132396881 CGAGCCCGGGGGCGGCGGGGGGG - Intergenic
1076920074 10:133446590-133446612 CCAGCCCGGCGTGGGGGGAGGGG - Intergenic
1076922068 10:133459390-133459412 GAAGGACAGAGGGGGCGGAGAGG + Intergenic
1077183729 11:1227466-1227488 GAGGCCGGGAGGGGGCGGAGTGG + Intronic
1077531332 11:3097010-3097032 GAAGACGGGAGGGGGAGGAGAGG + Intronic
1078418158 11:11182871-11182893 CAAGCCTGGAGGGGGTGAGGAGG - Intergenic
1078420672 11:11209521-11209543 CAATCCTGGCGGGGGCGGGGGGG + Intergenic
1081870361 11:46380348-46380370 GAAGCCCGGAGGAGGTGGGGTGG - Exonic
1082076705 11:47980759-47980781 GAAGCCCGGGGCGGGCGGAGCGG + Exonic
1083876075 11:65525076-65525098 CGAGCCGGGGCGGGGCGGAGAGG - Exonic
1084021511 11:66420784-66420806 CAAGCCTGGCGGGAGCTGAGCGG - Intergenic
1084114352 11:67033160-67033182 AAAGCCCAGAGTGGGCAGAGTGG - Intronic
1084495145 11:69499039-69499061 CAAGCCTGGAGGAGGCGGAGTGG - Intergenic
1084692369 11:70734718-70734740 CAAGACCGAAGGGTGCTGAGGGG + Intronic
1085031632 11:73274832-73274854 CAAGGCAGGAGGGGGCAGGGTGG - Intronic
1085310045 11:75510758-75510780 GAGGCCCGGAGGAGGAGGAGGGG - Intronic
1087243030 11:95801820-95801842 CAAGCAGGGAGGAGACGGAGAGG + Intronic
1089216425 11:116837220-116837242 CAAGCTTGGAGGTGGGGGAGAGG + Intronic
1089554868 11:119310717-119310739 CAAAACGGGCGGGGGCGGAGGGG + Intronic
1089789794 11:120934400-120934422 GAAGCCCGGAGTGGGAGCAGGGG + Intronic
1091434322 12:460869-460891 CAAGCCCGGAGCGGCTGGAGGGG - Intronic
1091720895 12:2812730-2812752 CAAGAGCAGAGGGAGCGGAGAGG - Exonic
1091771029 12:3151497-3151519 CAAGGCTGGAGGGGGCCGACAGG - Intronic
1092256087 12:6927653-6927675 CAAGCCGCGAGGGGGGAGAGAGG - Intronic
1094031970 12:26022369-26022391 CAAGCCCAGAGAGGGAGGAGAGG + Intronic
1095741796 12:45615529-45615551 GAAGCCCGGAGGGGGAAGGGAGG - Intergenic
1096105961 12:48997291-48997313 CCAGCCCGGCGGGGGCCGCGGGG - Exonic
1096467143 12:51852888-51852910 CAGGCCCAGAGAGGGCAGAGTGG - Intergenic
1096642607 12:53006380-53006402 GAAGCTGGGAGGGGGCGGGGAGG - Exonic
1096806115 12:54142099-54142121 CAAGCTCTGAGGGAGCAGAGAGG - Intergenic
1097267755 12:57755613-57755635 CAACCCCGGGGGGGCCGGGGAGG + Exonic
1098898112 12:76085036-76085058 CAACGCCGAAGGGGGCGGGGCGG - Intergenic
1102357989 12:112255998-112256020 CAAGCACGGAGGGAGGGCAGGGG + Intronic
1103856088 12:123972460-123972482 CAGCGCCGGCGGGGGCGGAGGGG - Intronic
1103863779 12:124034994-124035016 AAAGGCAGGAGGGGTCGGAGGGG + Intronic
1106409331 13:29500055-29500077 CAAGCCAGGAGGGGGAAGATGGG - Intronic
1106602606 13:31200370-31200392 CAAGACCGAAAGGGGCCGAGCGG - Intronic
1108818260 13:54316316-54316338 TAAGCCGGGCGGGGGTGGAGAGG - Intergenic
1109470587 13:62799296-62799318 AAAGTCCGGAGGGGGCCGAGAGG - Intergenic
1109944977 13:69421013-69421035 CAAGCCTGCAGGGGCAGGAGGGG + Intergenic
1112960005 13:105112589-105112611 CAAGTGGGGGGGGGGCGGAGGGG - Intergenic
1117315472 14:54567336-54567358 CGGGTGCGGAGGGGGCGGAGGGG + Intronic
1118608691 14:67522752-67522774 CAAGCCTGGAGCGGGTGGTGAGG + Intronic
1118736356 14:68704335-68704357 GGAGCCCGGAAGGGGCGGAGAGG + Intronic
1119325838 14:73759291-73759313 CAGGCCCGGAAGGCGCGGCGAGG - Intronic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1121005733 14:90489538-90489560 CAAGCCCTGAGGGGCTGGGGAGG + Intergenic
1122542521 14:102506161-102506183 CAAGCCCGGAGTGGGCTTGGTGG - Exonic
1122700314 14:103583995-103584017 CATGCCCAGAGAGGGCGCAGGGG - Intronic
1122887576 14:104717252-104717274 CCTGCCCGGTGGGGGCGGACTGG - Intronic
1123112317 14:105878777-105878799 GAAGCCCGGAGCGGGCGCTGGGG - Intergenic
1124251073 15:28106857-28106879 CAGGCCCGGAGGCGGCCGCGGGG - Intergenic
1127342692 15:58065064-58065086 ACAGCCCGGAGGGTGCTGAGGGG - Intronic
1128511343 15:68315795-68315817 CAAGCCAGCAGGGGGCTGTGGGG - Intronic
1128992507 15:72272552-72272574 GACGCCCCGCGGGGGCGGAGCGG + Exonic
1131369108 15:91865029-91865051 CAACCACGGAGGGGGCAGAAAGG - Intronic
1132670486 16:1100480-1100502 CCAGCCTGGAGGGGACGGGGAGG - Intergenic
1133771271 16:8868495-8868517 CAGGCCCGGCGGGGGAGGTGGGG - Intronic
1136356081 16:29745543-29745565 CAAGACTTGAGGGGGCCGAGTGG - Intronic
1136565036 16:31064730-31064752 AAAGCCCGTTGGGGGCGGGGGGG - Intronic
1137830014 16:51535695-51535717 CAAGCAAGGAGGAGGCGGCGAGG + Intergenic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1138714259 16:59003670-59003692 CAAGCCTGGAGTGGGTGGACTGG - Intergenic
1139593030 16:67943723-67943745 CTAACCCAGGGGGGGCGGAGTGG - Exonic
1139754532 16:69132244-69132266 CAAGCCCGGAGGGGCCTCCGGGG - Intronic
1141526309 16:84614237-84614259 CAAGAGCGGAGGTAGCGGAGGGG + Intronic
1142372477 16:89690825-89690847 CCAGACAGGAGGGGGAGGAGGGG - Intronic
1142833069 17:2563762-2563784 TAACCCCGGAGGAGGTGGAGTGG - Intergenic
1145413707 17:22695281-22695303 CAAGCCGGAGGGAGGCGGAGGGG - Intergenic
1145863766 17:28227501-28227523 CAGGCGCGGGGCGGGCGGAGCGG + Intergenic
1147326666 17:39672945-39672967 CAAGGTGGGAGGGGGCGGATGGG + Intronic
1147455637 17:40536516-40536538 CAAGGCGGGAAGGGGTGGAGAGG + Intergenic
1147891577 17:43720944-43720966 AAAGGGCGGAGGGGACGGAGGGG + Intergenic
1147921667 17:43920966-43920988 AAAGCCAGAAGGGGGTGGAGTGG - Intergenic
1147971554 17:44221027-44221049 GCCGCCCGGAGGAGGCGGAGGGG - Intronic
1148332908 17:46822570-46822592 CGGGCCCGCAGGGAGCGGAGTGG - Intronic
1148778866 17:50110621-50110643 CAAGCCCTGAGCGGAGGGAGAGG - Exonic
1148798990 17:50211220-50211242 CATGCTGGGAGGGGGTGGAGAGG - Intergenic
1150294377 17:64000030-64000052 TCAGCTCGGAGGAGGCGGAGAGG + Intronic
1151218360 17:72592847-72592869 CGCGCCGGGACGGGGCGGAGCGG + Intergenic
1151540219 17:74760975-74760997 CAGGCCTGGAGGAGGGGGAGAGG + Intronic
1152293618 17:79454379-79454401 CAGGCCAGGAGGGGCAGGAGGGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152924094 17:83079728-83079750 CGAGCCGGGCGGGGGCGGGGCGG - Exonic
1155007380 18:21741166-21741188 CTAGCCCGAGGGGGGCGGCGGGG - Intronic
1155493363 18:26420830-26420852 CACGCCACGAGGGGGCTGAGCGG - Intergenic
1160152431 18:76405509-76405531 CCAGCCCGGGAGGGGCGGCGTGG + Intronic
1160541667 18:79627339-79627361 CAGGCGAGGAGGGGGCAGAGTGG + Intergenic
1160660286 19:295012-295034 CAAGGACGGTGGTGGCGGAGGGG + Intergenic
1161161255 19:2762895-2762917 AAAGCCCAGAGCGGGCTGAGAGG + Intronic
1162947830 19:14054484-14054506 AAAGCCCGCTGGGGGCCGAGGGG - Exonic
1162965845 19:14155641-14155663 AAAGCCCTGAGCGGGCCGAGTGG + Intronic
1163203665 19:15786994-15787016 CAAGCCCAGATGGAGTGGAGGGG - Intergenic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1163491421 19:17619172-17619194 CAAGCCTGGGTGGGGCTGAGAGG - Intronic
1163729583 19:18941294-18941316 AAAGCCGGCAGGGGGCGCAGCGG - Intergenic
1163830713 19:19545981-19546003 CTACCCCGGCGGGTGCGGAGGGG - Exonic
1165308024 19:35013998-35014020 CAAGCCTGGCAGGGGCTGAGAGG + Intronic
1166121805 19:40691027-40691049 CCAGCCCGGCGGGGGCGGGCAGG + Intergenic
1166765751 19:45251498-45251520 CCAGGCCGGCGGGGGGGGAGGGG + Exonic
1166824773 19:45601995-45602017 CAGCCCCCGAGGGGGCGGGGAGG + Intronic
1167463552 19:49638682-49638704 CCAGCCCGGAGGTGGCTCAGGGG + Intronic
1167466886 19:49654786-49654808 CCAGCCCGGTGGGGGTGGGGGGG - Exonic
1167618811 19:50550214-50550236 CAGGCCGGGAGGGCGCAGAGGGG + Intronic
1167967375 19:53158440-53158462 AAAGCCCGGGGCGGGAGGAGGGG + Intronic
1168318345 19:55493972-55493994 CAAGTTCGGCGGGGGCGGGGGGG + Intronic
926337461 2:11875163-11875185 CAGGGGCGGAGGGGGCGGAGGGG - Intergenic
926732979 2:16051102-16051124 CAAGCCCCGAGGTGGGGGTGGGG - Intergenic
928395375 2:30939565-30939587 CAGGCCCGGAAGGGGTGGGGAGG + Intronic
931777780 2:65554990-65555012 CAAGCCCGGAGGCTGGGGTGTGG + Intergenic
932303757 2:70686992-70687014 CCAGCCAGGAGAGGGCGGACGGG + Intronic
934908522 2:98228587-98228609 CAAGCAATGAGAGGGCGGAGAGG + Intronic
935518818 2:104078535-104078557 AAAGTCCAGAGGGGGCTGAGGGG + Intergenic
935594248 2:104867319-104867341 CGAGCCCGGAGGGAACCGAGGGG + Intergenic
936972185 2:118186454-118186476 CAAGCCCGGAACTGGCGGAGGGG - Intergenic
937097926 2:119247799-119247821 CAGGCCGGGAGGAGGCGCAGGGG - Exonic
937886847 2:126905681-126905703 CAAGGCTGGAGAGGGCGGAGAGG - Intergenic
938537147 2:132256467-132256489 CATGCGCGGAGGGCGCGGGGCGG + Intronic
938595543 2:132784006-132784028 CCTGCCTGGAGGGGGCGGAGGGG + Exonic
941367030 2:164621570-164621592 AAGGCGCGGAGGGGGCGGGGAGG + Exonic
942428408 2:175883736-175883758 CAAGGCCGGTGGGGGCAGGGAGG + Intergenic
947593169 2:231396237-231396259 AAAGCCCGGGAGGGGCGGAGAGG - Intronic
947748735 2:232522330-232522352 CCAGCCCGGAGGGGGTGGCACGG + Intronic
947826026 2:233106606-233106628 GAAGCCCAGAGGAGGAGGAGGGG - Intronic
948202196 2:236137242-236137264 CTTGCCCGGAGGAGGCTGAGGGG + Intergenic
948983910 2:241508580-241508602 AAAGCCCGGAGGCGACGGCGAGG + Exonic
948988651 2:241541077-241541099 CAAGCAGGGCGGGCGCGGAGCGG - Intergenic
1169758672 20:9068583-9068605 CGAGCCCGCAGGGCGAGGAGTGG - Intergenic
1170780834 20:19423900-19423922 CAAGCCTGGAGGGGTAGGGGAGG + Intronic
1172941677 20:38658678-38658700 CAAGCGGGCAGGGGGCAGAGTGG + Intergenic
1173620812 20:44434512-44434534 CAAGCGCGGGGGGGGGGGGGTGG + Intergenic
1174404512 20:50294703-50294725 CAGGCCCAGAGGTGGCGGTGAGG + Intergenic
1175285581 20:57834573-57834595 AAAGCTCGGAGGGGGCTCAGAGG - Intergenic
1175864687 20:62168991-62169013 CAAGCCAGGAGGGGACAGCGGGG + Intronic
1175944828 20:62553811-62553833 CAAGCCCAGAGAGGGCTGGGTGG - Intronic
1176050846 20:63118935-63118957 GAAGGCAGGAGGGGGCGGGGAGG - Intergenic
1176127429 20:63482281-63482303 CCAGCCTGGAGGGGTTGGAGGGG - Intergenic
1179928245 21:44550307-44550329 CAGGGCGGGAGGGGGCAGAGTGG - Intronic
1179930559 21:44568504-44568526 CACGCCCAGAGGGGGACGAGGGG - Intronic
1179939440 21:44628406-44628428 CAGGGCGGGAGGGGGCAGAGTGG + Intronic
1181979100 22:26753332-26753354 CTAGCCAGGAGGGGGCAGATGGG + Intergenic
1182294900 22:29306973-29306995 CCTGCCCGGAGGGGGCGGGCGGG - Intronic
1182770870 22:32795431-32795453 TAACCCCGGAGGGGACTGAGGGG + Intronic
1184047660 22:41981613-41981635 CAAGGTGGGAGGGGTCGGAGGGG - Intronic
1184095691 22:42315109-42315131 CAAGCAGGGAGGGGGCAGACAGG + Intronic
1184523256 22:45007901-45007923 GGGGCCCGGAGGGGGGGGAGCGG + Intronic
1184950569 22:47839780-47839802 CAGGAGCGGAGGGGGAGGAGCGG - Intergenic
1185043188 22:48516026-48516048 CAAGGCCGGCGGGTGCTGAGCGG - Intronic
1185077338 22:48690455-48690477 CAAGCATGGAGGGGCTGGAGAGG - Intronic
1185176069 22:49327681-49327703 CAAGCTGGGAGGGAGCTGAGGGG + Intergenic
950105865 3:10388028-10388050 CTGGCCCGGAGGGGAAGGAGGGG + Intronic
950961345 3:17111207-17111229 CCAGCCTGGAGGAGGCGGATTGG + Intergenic
954377508 3:50202937-50202959 CAAGCCCGGGGGAGGTGAAGAGG + Intergenic
954703762 3:52467413-52467435 CACGCCAGGAGGAGGCGGGGTGG - Intronic
957847356 3:85755237-85755259 CCAACCTGGAGGGGGAGGAGAGG - Intronic
959085652 3:101849161-101849183 CAGGCCCGGCGGGGGCCTAGAGG + Intronic
960057440 3:113285339-113285361 CAAGCCCAGATGGGGAGGTGGGG - Intronic
961327775 3:126119529-126119551 CAAGCCTGGAGGCAGGGGAGTGG - Intronic
961627853 3:128276011-128276033 CAGGGCATGAGGGGGCGGAGTGG - Intronic
961674312 3:128555522-128555544 CGCGCCCCGAGGGGGCGGACGGG - Intergenic
963870171 3:150408198-150408220 GGAAACCGGAGGGGGCGGAGCGG + Intergenic
964129640 3:153272564-153272586 CAGAGCAGGAGGGGGCGGAGGGG - Intergenic
967849551 3:194071415-194071437 CACGCCCGGCGGGGGCGGAGGGG + Intergenic
967891054 3:194364894-194364916 AAAGCCCGCAGGGGAGGGAGGGG + Intronic
968450911 4:675545-675567 CAAGCCAGGAGAGGGGGCAGAGG - Intronic
968912501 4:3483319-3483341 CAAGACCGGGGGGGGCTGGGTGG + Intronic
970193976 4:13538790-13538812 CAAGCCCAGAGAAGGCCGAGAGG + Intergenic
973607174 4:52599429-52599451 GAAGACCAGAGGGGGCTGAGGGG + Intronic
973619392 4:52712275-52712297 CAATCCCGGATGGGGCGGGACGG - Intergenic
975800835 4:78057823-78057845 TCAGCCCGGAGGCGCCGGAGCGG - Exonic
976427957 4:84928242-84928264 CAAGCACGGAGGAGGGAGAGGGG - Intronic
978123556 4:105110287-105110309 CCCTCCCGGATGGGGCGGAGGGG - Intergenic
982157266 4:152535383-152535405 GACCCCCGGAGGGGGCTGAGGGG + Exonic
985763630 5:1764983-1765005 CATGCCAGGAGGAGGAGGAGGGG - Intergenic
985894611 5:2740886-2740908 TAAGCTCGGAGGGGGCGAGGAGG - Intergenic
986689970 5:10306352-10306374 TGAGCCCGGAGGGGGCAGAGAGG + Intronic
986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG + Exonic
988518143 5:31922756-31922778 TGAGCCCGGAGGGGGGGGCGGGG - Intronic
989534314 5:42546407-42546429 CAAGCCAGCAGGGTGAGGAGGGG + Intronic
996065147 5:119071362-119071384 GAGGCCCGGAGGGGGCGGGTCGG - Intronic
998108698 5:139484863-139484885 CAAGCCTTCAGAGGGCGGAGGGG + Intergenic
1000052685 5:157575885-157575907 CCAGCCCGGAGGGGGCTGGAGGG + Intergenic
1002899711 6:1400474-1400496 CAAGCCTGGAGTGTGGGGAGAGG + Intergenic
1007378612 6:41472444-41472466 CAAGCCCTGTTGGGGTGGAGGGG - Intergenic
1007431565 6:41780084-41780106 CAAGCCCGGAGGGGACAGGGCGG + Intronic
1007595178 6:43046723-43046745 CAGGCCCAGATGGGGCAGAGGGG + Intronic
1013491059 6:110646589-110646611 CAACGGCGGAGGGGGCGGGGAGG + Intronic
1015384358 6:132605154-132605176 CATGCCCAGACTGGGCGGAGAGG + Intergenic
1016938553 6:149466278-149466300 CGAGATGGGAGGGGGCGGAGAGG + Intronic
1018238941 6:161753691-161753713 CAAGCCCAATGGGGGCGGGGGGG + Intronic
1020272367 7:6604847-6604869 CAAAGCCTGAGGGGGCGGAAGGG + Intronic
1022103959 7:27185374-27185396 GAAGCCGGGAGGGAGGGGAGAGG - Intergenic
1025244751 7:57308743-57308765 CCAGCCCGGAGTGGTGGGAGGGG - Intergenic
1029643015 7:101832897-101832919 CATGCAGGGAGGGGCCGGAGAGG + Intronic
1031836363 7:126685493-126685515 CAAGCCTGCAGGGGTCAGAGGGG - Intronic
1032490687 7:132321858-132321880 GAAGCCTGGGTGGGGCGGAGGGG + Intronic
1035573131 8:687526-687548 CACGCGCTGAGGGGGCGCAGGGG + Intronic
1035731479 8:1856648-1856670 CAGCTCCGGAGGGGGCTGAGGGG - Intronic
1037811369 8:22089118-22089140 CGGGCCGGGAAGGGGCGGAGCGG + Intergenic
1040593213 8:48815405-48815427 CAGGCCAGGAGGGGGTGGGGTGG - Intergenic
1043502755 8:80873693-80873715 GAAGCCCCGAGGGGGCGCGGAGG - Intronic
1045582661 8:103498813-103498835 CCCTCCCGGAGGGGGCGGGGCGG - Intergenic
1045847675 8:106657555-106657577 CGAGCGCGGACGGGGCGGGGAGG + Intronic
1048990840 8:139759263-139759285 CAAAGCCGGAAGGGGCGGGGAGG + Intronic
1049513142 8:143039743-143039765 GAAGCCGGGAGGGTGTGGAGAGG + Intronic
1049585671 8:143431341-143431363 GAAGCACGGGGCGGGCGGAGGGG + Intergenic
1059438954 9:114292033-114292055 TAAGGCAGGAGGAGGCGGAGGGG - Intronic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1061550409 9:131331346-131331368 CAAGTGGGGAGGGGGCGCAGGGG - Intergenic
1062579400 9:137222700-137222722 CAAGAGCGGGGCGGGCGGAGCGG + Intergenic
1189407117 X:40735355-40735377 CCCGCCCGGAGGCGGCGGCGGGG - Exonic
1190061947 X:47217454-47217476 GAAGCCCGGAAGAGGCGGGGAGG + Intergenic
1190246279 X:48692620-48692642 CAAGTCCTGAGGAGGCAGAGAGG - Intergenic
1194174497 X:90629504-90629526 CAAGCACAGTGGGGGCGGGGAGG - Intergenic
1197764563 X:130051433-130051455 GAAGCCCAGAGGGGGCTGAGCGG - Intronic
1200520712 Y:4207197-4207219 CAAGCACAGTGGGGGCGGGGAGG - Intergenic