ID: 986691399

View in Genome Browser
Species Human (GRCh38)
Location 5:10316625-10316647
Sequence GTCAAGAAGCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986691399_986691406 11 Left 986691399 5:10316625-10316647 CCCTGCTCCTTCTGCTTCTTGAC No data
Right 986691406 5:10316659-10316681 CTTCCCAGCGTAGCCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986691399 Original CRISPR GTCAAGAAGCAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr