ID: 986693983

View in Genome Browser
Species Human (GRCh38)
Location 5:10335896-10335918
Sequence TGCCTCTGGTGTGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986693981_986693983 4 Left 986693981 5:10335869-10335891 CCAGCAATGGGACAAATAGGCAA No data
Right 986693983 5:10335896-10335918 TGCCTCTGGTGTGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986693983 Original CRISPR TGCCTCTGGTGTGCTGCAGC AGG Intergenic
No off target data available for this crispr