ID: 986694410

View in Genome Browser
Species Human (GRCh38)
Location 5:10339317-10339339
Sequence TCATCCATGGCCATCACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986694410_986694425 17 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694425 5:10339357-10339379 CATTTTGCTGTTGGAGGTGGGGG No data
986694410_986694427 22 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694427 5:10339362-10339384 TGCTGTTGGAGGTGGGGGCTGGG No data
986694410_986694432 30 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694432 5:10339370-10339392 GAGGTGGGGGCTGGGGGTTGGGG No data
986694410_986694415 8 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694415 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
986694410_986694417 11 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694417 5:10339351-10339373 AGCCCCCATTTTGCTGTTGGAGG No data
986694410_986694430 28 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694430 5:10339368-10339390 TGGAGGTGGGGGCTGGGGGTTGG No data
986694410_986694431 29 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694431 5:10339369-10339391 GGAGGTGGGGGCTGGGGGTTGGG No data
986694410_986694424 16 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694424 5:10339356-10339378 CCATTTTGCTGTTGGAGGTGGGG No data
986694410_986694428 23 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694410_986694426 21 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694426 5:10339361-10339383 TTGCTGTTGGAGGTGGGGGCTGG No data
986694410_986694429 24 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694429 5:10339364-10339386 CTGTTGGAGGTGGGGGCTGGGGG No data
986694410_986694422 15 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694422 5:10339355-10339377 CCCATTTTGCTGTTGGAGGTGGG No data
986694410_986694420 14 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694420 5:10339354-10339376 CCCCATTTTGCTGTTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986694410 Original CRISPR TCATCCATGGCCATCACGCT GGG (reversed) Intergenic
No off target data available for this crispr