ID: 986694412

View in Genome Browser
Species Human (GRCh38)
Location 5:10339330-10339352
Sequence CTGGGAGCAGGAATCATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986694412_986694429 11 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694429 5:10339364-10339386 CTGTTGGAGGTGGGGGCTGGGGG No data
986694412_986694427 9 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694427 5:10339362-10339384 TGCTGTTGGAGGTGGGGGCTGGG No data
986694412_986694417 -2 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694417 5:10339351-10339373 AGCCCCCATTTTGCTGTTGGAGG No data
986694412_986694430 15 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694430 5:10339368-10339390 TGGAGGTGGGGGCTGGGGGTTGG No data
986694412_986694434 19 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694434 5:10339372-10339394 GGTGGGGGCTGGGGGTTGGGGGG No data
986694412_986694415 -5 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694415 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
986694412_986694424 3 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694424 5:10339356-10339378 CCATTTTGCTGTTGGAGGTGGGG No data
986694412_986694426 8 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694426 5:10339361-10339383 TTGCTGTTGGAGGTGGGGGCTGG No data
986694412_986694431 16 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694431 5:10339369-10339391 GGAGGTGGGGGCTGGGGGTTGGG No data
986694412_986694428 10 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694412_986694433 18 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694433 5:10339371-10339393 AGGTGGGGGCTGGGGGTTGGGGG No data
986694412_986694420 1 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694420 5:10339354-10339376 CCCCATTTTGCTGTTGGAGGTGG No data
986694412_986694425 4 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694425 5:10339357-10339379 CATTTTGCTGTTGGAGGTGGGGG No data
986694412_986694422 2 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694422 5:10339355-10339377 CCCATTTTGCTGTTGGAGGTGGG No data
986694412_986694432 17 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694432 5:10339370-10339392 GAGGTGGGGGCTGGGGGTTGGGG No data
986694412_986694435 20 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694435 5:10339373-10339395 GTGGGGGCTGGGGGTTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986694412 Original CRISPR CTGGGAGCAGGAATCATCCA TGG (reversed) Intergenic
No off target data available for this crispr