ID: 986694414

View in Genome Browser
Species Human (GRCh38)
Location 5:10339348-10339370
Sequence CCAACAGCAAAATGGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986694414_986694428 -8 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694414_986694431 -2 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694431 5:10339369-10339391 GGAGGTGGGGGCTGGGGGTTGGG No data
986694414_986694433 0 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694433 5:10339371-10339393 AGGTGGGGGCTGGGGGTTGGGGG No data
986694414_986694435 2 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694435 5:10339373-10339395 GTGGGGGCTGGGGGTTGGGGGGG No data
986694414_986694429 -7 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694429 5:10339364-10339386 CTGTTGGAGGTGGGGGCTGGGGG No data
986694414_986694434 1 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694434 5:10339372-10339394 GGTGGGGGCTGGGGGTTGGGGGG No data
986694414_986694427 -9 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694427 5:10339362-10339384 TGCTGTTGGAGGTGGGGGCTGGG No data
986694414_986694426 -10 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694426 5:10339361-10339383 TTGCTGTTGGAGGTGGGGGCTGG No data
986694414_986694430 -3 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694430 5:10339368-10339390 TGGAGGTGGGGGCTGGGGGTTGG No data
986694414_986694436 30 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694436 5:10339401-10339423 AGCAGCACAGACCAAACAGAAGG No data
986694414_986694432 -1 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694432 5:10339370-10339392 GAGGTGGGGGCTGGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986694414 Original CRISPR CCAACAGCAAAATGGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr