ID: 986694428

View in Genome Browser
Species Human (GRCh38)
Location 5:10339363-10339385
Sequence GCTGTTGGAGGTGGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986694413_986694428 -2 Left 986694413 5:10339342-10339364 CCTGCTCCCAGCCCCCATTTTGC No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694414_986694428 -8 Left 986694414 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694416_986694428 -9 Left 986694416 5:10339349-10339371 CCAGCCCCCATTTTGCTGTTGGA No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694411_986694428 22 Left 986694411 5:10339318-10339340 CCAGCGTGATGGCCATGGATGAT No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694412_986694428 10 Left 986694412 5:10339330-10339352 CCATGGATGATTCCTGCTCCCAG No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data
986694410_986694428 23 Left 986694410 5:10339317-10339339 CCCAGCGTGATGGCCATGGATGA No data
Right 986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986694428 Original CRISPR GCTGTTGGAGGTGGGGGCTG GGG Intergenic
No off target data available for this crispr