ID: 986697738

View in Genome Browser
Species Human (GRCh38)
Location 5:10373639-10373661
Sequence GCCCTCCAGGAACATCGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986697738_986697742 -7 Left 986697738 5:10373639-10373661 CCGTCACGATGTTCCTGGAGGGC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 986697742 5:10373655-10373677 GGAGGGCAGCGTCCCACGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 172
986697738_986697741 -10 Left 986697738 5:10373639-10373661 CCGTCACGATGTTCCTGGAGGGC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 986697741 5:10373652-10373674 CCTGGAGGGCAGCGTCCCACGGG No data
986697738_986697743 -6 Left 986697738 5:10373639-10373661 CCGTCACGATGTTCCTGGAGGGC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 986697743 5:10373656-10373678 GAGGGCAGCGTCCCACGGGTGGG No data
986697738_986697746 15 Left 986697738 5:10373639-10373661 CCGTCACGATGTTCCTGGAGGGC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 986697746 5:10373677-10373699 GGACACCCTTTGTCATGCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986697738 Original CRISPR GCCCTCCAGGAACATCGTGA CGG (reversed) Intronic
910083774 1:83373363-83373385 GCACTCCAGGAACAGTGTGTAGG + Intergenic
910291886 1:85607404-85607426 CCCCACCAGGAAGAACGTGAGGG - Intergenic
911121584 1:94302237-94302259 TCCCTCCTGGAAGATGGTGATGG - Intergenic
912370807 1:109172657-109172679 GCCCTCCAGGGACATTGGGGTGG - Intronic
913666849 1:121056739-121056761 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914018593 1:143844175-143844197 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914657148 1:149752378-149752400 GCCCTCCTGGACCATGGTAAGGG - Intergenic
916018786 1:160775313-160775335 CCCCTCCAGCTACATCCTGATGG - Intergenic
920071782 1:203307402-203307424 CCCCTCCAAGAACTACGTGATGG + Exonic
1064217150 10:13410006-13410028 GCCCTCCAGGCAAATCCGGATGG - Intergenic
1067655132 10:48186166-48186188 GCTCTCCAGGAACAGCTTCAGGG - Intronic
1068823694 10:61409338-61409360 GCTCTCAGGGAACATGGTGATGG - Exonic
1068862138 10:61858179-61858201 CCTCTCCAGGAAAATCCTGAAGG + Intergenic
1069438355 10:68406725-68406747 GCCCCCCAGGACCATCGCGGCGG + Intronic
1071821561 10:89285817-89285839 GCACCCCAGGAACATGGGGAAGG - Intronic
1074838286 10:117322298-117322320 GACCTCGAGGAACATGGTAAAGG + Intronic
1075589120 10:123678685-123678707 CCCCTCCAGGCACACCCTGATGG + Intronic
1083195352 11:61082618-61082640 TCCCTTCAGGAATATCGGGAGGG + Intergenic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1084964232 11:72735897-72735919 GCCCTCCAGGAACCTCAGGCTGG + Intronic
1088408769 11:109510447-109510469 GCCTTCCAGGAACATAGAGATGG + Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1097171394 12:57115729-57115751 GCACTCCAGCAACAGAGTGAGGG + Intronic
1107988588 13:45797359-45797381 GACCTCTAGGATCATCCTGAAGG + Intronic
1112345686 13:98587303-98587325 GCCTTCCAGGAACATCACCATGG + Intergenic
1118070337 14:62239824-62239846 GGCCTTCAGGGACATCGAGAAGG + Intergenic
1118693817 14:68364453-68364475 TCCCTCCAGGCACAGCGGGAAGG - Intronic
1119912617 14:78363819-78363841 ATCCTCCAGGAAAATCATGAGGG - Intronic
1123216716 14:106814813-106814835 CCCATCCAGGAACATCTGGAGGG + Intergenic
1126467344 15:48973080-48973102 GCCCTCCAGCAGCTTCGTGTAGG - Intergenic
1137001167 16:35232423-35232445 GCTGTCCAGGAACATGGGGATGG - Intergenic
1140055428 16:71521567-71521589 GGCCTCCAGGAAGATAGTGGTGG - Intronic
1144762788 17:17716885-17716907 GCCACCCAGGGACATCGGGATGG - Intronic
1145963137 17:28898848-28898870 GCCATCCAGGAACATGGCGCAGG + Exonic
1147350038 17:39835223-39835245 GCCCTCCAGCAACTTCCTGTAGG + Intronic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1147447733 17:40484966-40484988 GCCCACCATGAAGTTCGTGATGG - Exonic
1148794845 17:50192009-50192031 GGTCTCCAGGAACACCCTGAGGG + Exonic
1151980848 17:77507539-77507561 TCCCTCCAGGGACACGGTGATGG - Intergenic
1155143512 18:23064635-23064657 CCCCTCCAGCAACATAATGAGGG + Intergenic
1156237195 18:35216923-35216945 GCCCCCCAGGAAAGTGGTGAAGG - Intergenic
1160942615 19:1627459-1627481 GACCCCAAGGAACATCCTGAGGG + Intronic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
1168145078 19:54415990-54416012 GGCCTCCAGGGTCATCGGGAGGG + Intronic
927145929 2:20166548-20166570 GCCTGCCAAGGACATCGTGAGGG + Intergenic
927650920 2:24913288-24913310 GCCCACAGGGAACATCGTCATGG + Intronic
930019589 2:46993441-46993463 TCCCACCAGGAACATCGTGAAGG + Exonic
934713596 2:96530693-96530715 CCCCACCAGGAACCTCGGGAGGG + Intergenic
1168731199 20:82737-82759 GCCCTCCAGGAAGACCATTAAGG - Intergenic
1172620314 20:36314114-36314136 GCCTTCCAGGGACAGCGTGCTGG + Intronic
1172768672 20:37364379-37364401 GCCACCCAGGAGCACCGTGATGG + Intronic
1172793537 20:37522350-37522372 GCATTCCAGGAACACCTTGAAGG - Exonic
1173976927 20:47194184-47194206 GCCCTATAGGAGCATCGTAAAGG + Intergenic
1175340093 20:58223129-58223151 TCCCTCCAGGAACAACATCATGG + Exonic
1176290700 21:5043134-5043156 GCCCTCCAGCAACGTCCTGGAGG - Intergenic
1179866555 21:44220507-44220529 GCCCTCCAGCAACGTCCTGGAGG + Intergenic
1182162989 22:28142154-28142176 GCCTCCAAGGTACATCGTGAAGG + Intronic
1184308900 22:43628405-43628427 GTCCTGCAGGAACCTCGTGATGG + Intronic
1184807053 22:46802117-46802139 GCCCTGCAGGGTCCTCGTGAAGG + Intronic
1185365673 22:50435656-50435678 GCACCCCAGGACCATAGTGAGGG + Intronic
950059769 3:10060810-10060832 GGCCTCAAGGAACAAGGTGAGGG - Intronic
950556889 3:13701377-13701399 GCTCTCAAGGAACAGCGAGAAGG - Intergenic
956910864 3:73815524-73815546 GCCCTCCACCATGATCGTGAGGG + Intergenic
959674121 3:109015234-109015256 GACCTCCAGTAACAGGGTGAAGG + Intronic
963781020 3:149486827-149486849 GGCCTCGAGGAACATAATGAGGG + Intronic
965862170 3:173160590-173160612 GCCCTCCAGGAAAGTGGAGAAGG + Intergenic
978374728 4:108062637-108062659 TCCCTCCAGGAGCAACGTGAAGG + Intronic
983883933 4:172960956-172960978 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883965 4:172961073-172961095 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883999 4:172961190-172961212 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
985933542 5:3078024-3078046 ACCCTCCAGGAACCACGGGAGGG + Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
989008009 5:36836937-36836959 GGACCCCAGGAACATCCTGATGG + Intergenic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
1002334435 5:178468266-178468288 CCCCTGCAGGAAGATCGGGAAGG + Intronic
1004179058 6:13365229-13365251 GCCCTCCAGCACCATCTGGAAGG + Exonic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1009887300 6:69639148-69639170 GACCTCCAGGGACATGGCGAGGG - Intergenic
1017130245 6:151102469-151102491 GCCCCCCAGGCACATCCTGCAGG + Intergenic
1017931644 6:158960619-158960641 GCTTTCCAGAAAGATCGTGAGGG + Intergenic
1018963343 6:168464403-168464425 GCCCTCCTGGCAGATAGTGATGG - Intronic
1019287394 7:230487-230509 GCCCCACAGGAGCCTCGTGAAGG - Intronic
1019409422 7:900131-900153 GCTCTCCAGGAACTACCTGAAGG - Exonic
1019609795 7:1930637-1930659 GCCCCCAAGGAACAAGGTGAAGG - Intronic
1023612013 7:41981158-41981180 GCCTTTGAGGAACAGCGTGAGGG + Intronic
1034443884 7:151101854-151101876 GCCTTCCAGGAACAGAGGGACGG - Intronic
1035575031 8:698928-698950 GCTCTCCAGGATCATCCTGCAGG + Intronic
1049174360 8:141182572-141182594 CCCCTCCAGGAGCATCTCGAAGG + Intronic
1061024754 9:128041263-128041285 GCCCTCCAGGAACCTCAGCATGG - Intergenic
1187479709 X:19643991-19644013 GCCCTCTAGGAACAGCATGGTGG - Intronic
1195080165 X:101363001-101363023 GCCTTACAGGAACATTGTAATGG - Intronic
1198533549 X:137566690-137566712 TCCGTCCAGGAGCATCGTCATGG - Exonic