ID: 986700224

View in Genome Browser
Species Human (GRCh38)
Location 5:10400009-10400031
Sequence ATCTGGGACAAATCCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986700221_986700224 1 Left 986700221 5:10399985-10400007 CCTTATTAGATTCAGGTTGAATA 0: 1
1: 0
2: 4
3: 10
4: 136
Right 986700224 5:10400009-10400031 ATCTGGGACAAATCCATCACTGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986700224 Original CRISPR ATCTGGGACAAATCCATCAC TGG Intronic
901428762 1:9199666-9199688 GTCTGGGCCAAAGCCACCACGGG - Intergenic
905025733 1:34848046-34848068 ATCAGGGTCAAATTCATCATGGG + Intronic
914076458 1:144356966-144356988 AACTAGGACAGATTCATCACTGG - Intergenic
914102720 1:144609531-144609553 AACTAGGACAGATTCATCACTGG + Intergenic
914170905 1:145222546-145222568 AACTAGGACAGATTCATCACTGG - Intergenic
914526019 1:148466514-148466536 AACTAGGACAGATTCATCACTGG - Intergenic
914640383 1:149600609-149600631 AACTAGGACAGATTCATCACTGG + Intergenic
919425643 1:197426914-197426936 ACCTGGGACAAATACATTCCAGG + Intronic
922804788 1:228379672-228379694 AGCCAGGACAACTCCATCACTGG - Intergenic
1063167846 10:3479945-3479967 ATCTTGAACGAGTCCATCACAGG + Intergenic
1072761186 10:98058298-98058320 ATCTGGGACAATTCCATATCTGG + Intergenic
1075945979 10:126433384-126433406 ATCTGGGAAAACTCCATAACAGG + Intronic
1076508000 10:130991026-130991048 AGCTGGGCCACATCCATCACCGG - Intergenic
1078457517 11:11486779-11486801 AGCTTGGACAAAGCCATCCCGGG - Intronic
1088676415 11:112197911-112197933 ATCTGGGAGAAATGCATTCCAGG - Intronic
1089800870 11:121025358-121025380 ATCTGGGTCTAATGCATCTCAGG - Intronic
1091816352 12:3441626-3441648 ATGAGGGACAAAGCCAGCACTGG + Intronic
1092043545 12:5407136-5407158 CTGTGGGTCAAATCCAGCACAGG - Intergenic
1095050460 12:37549618-37549640 ATGTGGGAAAAATCAATCAAAGG - Intergenic
1100323125 12:93515968-93515990 AGCTGGGACAAAGCTGTCACTGG - Exonic
1100357730 12:93847526-93847548 ATTTGGGTCAATTTCATCACAGG - Intronic
1100697590 12:97112215-97112237 ATCTGGGAGAAATGAATCTCAGG + Intergenic
1102289466 12:111687092-111687114 ATATGGGACACATACATGACAGG + Intronic
1104069108 12:125329311-125329333 AGCTGTAACAAATCCATCATAGG - Intronic
1106294765 13:28401799-28401821 GTATGAGACAAATCCATGACAGG - Intronic
1112634514 13:101200380-101200402 ATCAGGGACAAATGCAGAACTGG - Intronic
1114640360 14:24215644-24215666 ATCTCGTACAGTTCCATCACTGG + Exonic
1118736925 14:68707716-68707738 ATCTGCAACAAACCCATAACAGG + Intronic
1123137024 14:106037618-106037640 ACCTGGGCCAGATGCATCACTGG - Intergenic
1126334909 15:47576457-47576479 TTCTGAGATAAATTCATCACAGG - Intronic
1131394448 15:92075477-92075499 ATTTGGGATAAGTGCATCACTGG + Intronic
1131625259 15:94111405-94111427 ATCTGGGACAATTCAGTTACTGG - Intergenic
1134794033 16:17018243-17018265 AACTTGGACAAATCCCTCAAAGG + Intergenic
1137390871 16:48080463-48080485 TTATGTGACACATCCATCACAGG - Intergenic
1141030345 16:80582101-80582123 ATCTGGTACAAAGCCTTCAATGG + Intergenic
1144460123 17:15451673-15451695 ATCAGGGACACATGCATCCCAGG - Intronic
1146828455 17:36045621-36045643 ATCTGAGATAAATCCATCCAAGG - Intergenic
1149128652 17:53268268-53268290 ATGTGGTACATATTCATCACGGG + Intergenic
1154107950 18:11540428-11540450 GTCTGGCACAAATTCATGACTGG + Intergenic
1156457931 18:37305086-37305108 ATCTGGGAGAAGTGCAACACTGG + Intronic
1156605401 18:38660509-38660531 TTCTGGGACAAAGCCATAAAAGG + Intergenic
1158395384 18:57075362-57075384 CTCTGGGGCAAAACCATCCCTGG + Intergenic
1160078944 18:75704347-75704369 ATCTGGGGCCAATCCAGCAGAGG + Intergenic
1163658956 19:18565154-18565176 GTCTGGGACAATTCCAACCCTGG + Intronic
1164758444 19:30708468-30708490 ATCTGGGGCAAATAAATCACAGG + Intronic
1168181068 19:54663495-54663517 TTCCGGGGCAAATCCCTCACAGG + Intronic
926960603 2:18354580-18354602 ATCTTGGAAAGAGCCATCACAGG - Intronic
927207043 2:20617337-20617359 CTCTGGGACAGCTCCAGCACCGG - Intronic
931028910 2:58148011-58148033 TTCTGGCACAAATCCTTCAATGG + Intronic
933341117 2:81027063-81027085 ATTTATGACAAATCCATAACTGG - Intergenic
935038631 2:99404173-99404195 ATCTGGGGCAAACACATCAATGG - Intronic
937878800 2:126849845-126849867 ATCTGGGACTGATCCACCACTGG + Intergenic
938969000 2:136415113-136415135 ATCCGGGACAAGTGCATCCCAGG - Intergenic
941278983 2:163526309-163526331 TTCTGGGAGAACTCCACCACAGG + Intergenic
941885609 2:170524293-170524315 ATCTGAAACCAATCCAGCACTGG - Intronic
945826537 2:214727102-214727124 ATGTGGGACAAATGCATTACTGG + Exonic
946413983 2:219530179-219530201 CCCTGGGTCAAACCCATCACAGG - Intronic
946575312 2:221069478-221069500 ACTTGGACCAAATCCATCACAGG - Intergenic
948730117 2:239957739-239957761 TTTGGGGACAAGTCCATCACTGG + Exonic
1176081888 20:63277668-63277690 ATGTGGGACGCATCCATGACGGG - Intronic
1180004549 21:45014276-45014298 ACCCGGGTCAAATCCAGCACCGG + Intergenic
1181282549 22:21730218-21730240 ATCAGGGACATTTCCATCATGGG + Intronic
949920737 3:8998265-8998287 ATCTGGGAGAAAGGCATCCCAGG - Intronic
950170460 3:10835390-10835412 AGCTGTGAAGAATCCATCACGGG - Intronic
955103129 3:55871188-55871210 AGCTGGGACTAAGCCATGACTGG + Intronic
959238456 3:103756171-103756193 ATTTTGCCCAAATCCATCACAGG + Intergenic
959424903 3:106175369-106175391 ATCTGAGACACATTCATCCCAGG - Intergenic
964009749 3:151877735-151877757 ATCTGAGAGAAATCAATCAATGG + Intronic
967450361 3:189616277-189616299 AAGTGGGACAATTCCATGACTGG - Intergenic
969523923 4:7694586-7694608 CTCTGGGACACACGCATCACAGG - Intronic
969583261 4:8077641-8077663 AGCTGTGAGAAATACATCACGGG - Exonic
975741072 4:77429502-77429524 TTATGTGACAAATCCATTACAGG - Intronic
983820369 4:172185430-172185452 ATCTGCAACACATACATCACAGG + Intronic
985568281 5:631006-631028 GACTGGGTCAAATCCAGCACTGG - Intronic
985568481 5:631707-631729 GACTGGGTCAAATCCAGCACTGG - Intronic
985568522 5:631862-631884 GACTGGGTCAAATCCAGCACTGG - Intronic
985568902 5:633226-633248 GACTGGGTCAAATCCAGCACTGG - Intronic
985568942 5:633381-633403 GACTGGGTCAAATCCAGCACTGG - Intronic
986700224 5:10400009-10400031 ATCTGGGACAAATCCATCACTGG + Intronic
995425117 5:112012449-112012471 ATCTGGGATAATTCCTTCAAGGG + Intergenic
998875765 5:146597536-146597558 ATTTGGCAAAACTCCATCACTGG + Intronic
1001799169 5:174528535-174528557 ATCAGGTAGAAATTCATCACTGG + Intergenic
1016024006 6:139266442-139266464 ATCTGAAACACAACCATCACTGG + Intronic
1018751261 6:166808155-166808177 GGCTGGGACAGGTCCATCACAGG + Intronic
1021249836 7:18310645-18310667 ATCATGGACAATTCAATCACTGG - Intronic
1022975047 7:35549053-35549075 TGCTGGGACAGATCCATAACAGG + Intergenic
1023103208 7:36739741-36739763 ATTAGGGACTAATCCATCTCAGG + Intergenic
1023531125 7:41155537-41155559 ATCTGGGAAAGATCCACCATGGG - Intergenic
1030381179 7:108813568-108813590 TCCAGGGAGAAATCCATCACAGG + Intergenic
1030433708 7:109487728-109487750 ATCTGGCCCAAATCTATCATTGG + Intergenic
1038327874 8:26586274-26586296 ATGTAGCACAAATCCCTCACTGG - Intronic
1038785218 8:30608175-30608197 ATCTGGCAAAAATTCATCATAGG + Intronic
1042869583 8:73386212-73386234 ATTTGGGAAAGATCCATCCCAGG - Intergenic
1042946267 8:74157282-74157304 ATCTGGGACAAAGCTTTCAGAGG + Intergenic
1044865840 8:96570278-96570300 ATCTGGAACAAAAACATCACTGG - Intronic
1048521190 8:135156998-135157020 CTCTGGGACAAAGCCTTCAGAGG - Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1051958695 9:22731325-22731347 GTTTGGGAGAAATGCATCACTGG - Intergenic
1054798181 9:69321887-69321909 ATCTGGGGCAAATTTTTCACAGG + Intergenic
1186229705 X:7439894-7439916 CTCTGGGAAAAATCCATTCCAGG - Intergenic
1187237975 X:17485972-17485994 AGCTGGGACTAATATATCACAGG + Intronic
1189108775 X:38265203-38265225 ACCTGGGACAGATCCTTCCCAGG + Intronic
1194910556 X:99637535-99637557 AGCTTGGACTGATCCATCACTGG + Intergenic
1197634767 X:128902623-128902645 ATCTTGGACATCTCCATCCCAGG - Intergenic
1198870670 X:141175129-141175151 ATCTGGGACACATCTATGAGTGG + Intergenic
1198975522 X:142331746-142331768 ATCTGAAATAAATGCATCACTGG + Intergenic