ID: 986702566

View in Genome Browser
Species Human (GRCh38)
Location 5:10425302-10425324
Sequence TCCCTTCAGGATCAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986702558_986702566 17 Left 986702558 5:10425262-10425284 CCACCAGGAGTGTGATGGATTGG 0: 1
1: 0
2: 1
3: 12
4: 220
Right 986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
986702562_986702566 14 Left 986702562 5:10425265-10425287 CCAGGAGTGTGATGGATTGGGGG 0: 1
1: 0
2: 1
3: 5
4: 158
Right 986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986702566 Original CRISPR TCCCTTCAGGATCAGAGTGC AGG Intronic
900414513 1:2528869-2528891 TCCTTTAAGGATCATAGTGGAGG + Exonic
903833673 1:26189470-26189492 GCTCTTCAGGGTCAGAGGGCAGG - Exonic
905627028 1:39495888-39495910 TCCAGCCAGGATCAGAATGCAGG + Intronic
905669907 1:39784883-39784905 TCCAGCCAGGATCAGAATGCAGG - Intronic
906695445 1:47820315-47820337 TCCTTTCAGCAGCAGGGTGCTGG + Intronic
906963220 1:50432114-50432136 TCCCTTCAGAACCAGAATTCTGG + Intergenic
908481145 1:64540736-64540758 TCCCTGCTAAATCAGAGTGCAGG + Intronic
908892459 1:68862512-68862534 TCCTATCAGAATCAGATTGCTGG + Intergenic
913238751 1:116808921-116808943 TCCCTTCAGGCTGGAAGTGCAGG + Intergenic
915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG + Exonic
916421127 1:164638804-164638826 GACCTCCAGGGTCAGAGTGCCGG + Intronic
920824634 1:209413879-209413901 TCCCTTGAGGAACTCAGTGCTGG - Intergenic
921743321 1:218710584-218710606 TCCCTTTGAGATCAGAGTGATGG - Intergenic
922963402 1:229667247-229667269 TACCCTCAGAATCAGAGAGCTGG + Intergenic
923284931 1:232484811-232484833 GCCTTTCAGGCTCAGATTGCTGG - Intronic
1063013772 10:2053455-2053477 TCCCTGGATGATCAGAGTGAGGG + Intergenic
1067655251 10:48186949-48186971 TTCCTTCTGGACAAGAGTGCTGG + Intronic
1068931291 10:62593095-62593117 TCCCATAAGGAACAGACTGCAGG - Intronic
1069619277 10:69826533-69826555 TGCCTTCCGGGTCAGTGTGCTGG + Intronic
1075693883 10:124419290-124419312 TCCCTCCAGGAGCACAGGGCGGG - Intergenic
1078935442 11:15945424-15945446 GCCCTTCAGCATCAGGCTGCTGG - Intergenic
1087639616 11:100742367-100742389 TTCCTTGAGGAACACAGTGCAGG + Intronic
1089094985 11:115912568-115912590 TCCCTTCATGTCCAGAATGCTGG - Intergenic
1089321044 11:117626901-117626923 TTCCTGGAGGATCAGGGTGCTGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093199215 12:16167006-16167028 TCCCAGCAGGAACTGAGTGCCGG - Intergenic
1093199269 12:16167565-16167587 TCCCAGCAGGAACTGAGTGCCGG - Intergenic
1103911107 12:124352886-124352908 TCCCTGGAGGATCAGGGAGCTGG + Intronic
1104389166 12:128376953-128376975 TCCCTCCAGCATCAGAGAGATGG - Intronic
1106681178 13:32009612-32009634 TGCCTTCATGCTCACAGTGCAGG + Intergenic
1113982535 13:114288480-114288502 TCACTGCAGGCGCAGAGTGCAGG + Intronic
1119430671 14:74566491-74566513 TCCCCTGAGGATCTGGGTGCTGG + Intronic
1121140369 14:91536513-91536535 TGGCTTGAGGTTCAGAGTGCCGG + Intergenic
1121494987 14:94385949-94385971 TCAGTTCATGATCTGAGTGCTGG - Intronic
1128210661 15:65899020-65899042 TGCCTTCAGGATCTTAGAGCTGG + Intronic
1129340425 15:74882294-74882316 TCCCTCCAGGGGCTGAGTGCAGG - Intergenic
1130161641 15:81407563-81407585 ACCCTTCAGAATCAGAGCCCAGG + Intergenic
1134228115 16:12407903-12407925 TCCCTGCAGGCTCAAACTGCTGG - Intronic
1134230357 16:12424221-12424243 GCCCTTCAAGAGCAGAGTGTGGG + Intronic
1135878638 16:26230083-26230105 TCCCTTCAGCATCAAAGCCCAGG + Intergenic
1135992415 16:27226100-27226122 CACCTGCAGGATCTGAGTGCAGG - Intronic
1137257552 16:46789610-46789632 TCCCTTCAGCCTCACAGTGCTGG + Intronic
1142234420 16:88915153-88915175 TCCGTTGAGGATCCGTGTGCTGG + Intronic
1143850993 17:9811888-9811910 TCCCACCAGGATCAGACTGGGGG - Intronic
1144856259 17:18269878-18269900 ACCTTTCAGGTTCAGACTGCAGG + Intergenic
1146794860 17:35773813-35773835 TCCCTGCAGTGTCAGAGTGGAGG + Intronic
1150304851 17:64075874-64075896 TCCCTTCAGCATCAATGTCCTGG - Intronic
1150495576 17:65605541-65605563 TTCCTCAAGGATCAGAGAGCGGG + Intronic
1151541692 17:74767952-74767974 TCCTTTGGGGATCAGAGGGCAGG - Intronic
1151830057 17:76544335-76544357 TCCCTTCAGAGGCAGAGTGGCGG - Intronic
1152374795 17:79913524-79913546 GCCCCCCAAGATCAGAGTGCAGG + Intergenic
1152987146 18:331256-331278 TCCCTTCAGGATCACACTGTGGG - Intronic
1155237078 18:23831210-23831232 TCCCATCAGAATGTGAGTGCTGG - Intronic
1157216385 18:45786995-45787017 TCCTTCCAGGCTCAGAGTCCAGG + Intergenic
1158486216 18:57868353-57868375 TCTCTTCAGAAGCAGTGTGCAGG - Intergenic
1160284405 18:77527608-77527630 TCCTTTCATGCTCAGAGTGAAGG - Intergenic
1162545128 19:11324647-11324669 TCACTTCAGGATCAGAGATGTGG + Exonic
1164751390 19:30657587-30657609 TCCTTCCAGGAAGAGAGTGCAGG - Intronic
1167672109 19:50859354-50859376 TCCCTATGGGATCAGACTGCAGG + Intronic
1167674861 19:50877780-50877802 TCCCTTTGGGATCAGACTGCAGG + Intronic
924989003 2:295223-295245 TCCCTTCTGCAACAGAGTGTAGG + Intergenic
925012051 2:493544-493566 TCACATCAGGATAAGAGTTCAGG + Intergenic
925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG + Intergenic
925878021 2:8328594-8328616 TCTCTTCATGATAGGAGTGCTGG - Intergenic
929147703 2:38721209-38721231 TTCCTTCACTTTCAGAGTGCAGG + Intronic
929923835 2:46193304-46193326 CCACTTCTTGATCAGAGTGCAGG + Intergenic
932940487 2:76159221-76159243 TGCCTTCAGCATCACAGTCCTGG - Intergenic
940590978 2:155727182-155727204 TCCCTTTAGCAACATAGTGCTGG + Intergenic
943330487 2:186552807-186552829 TGCCTTCAGGATCAGAGCTCAGG + Intergenic
945979680 2:216299060-216299082 TCTTTTCAGGATCACAGTGGTGG - Intronic
1169468350 20:5861189-5861211 TCCTTTCAGAATAAGATTGCAGG + Intronic
1170928638 20:20748309-20748331 TCCCGTGGGGCTCAGAGTGCAGG + Intergenic
1174799590 20:53552075-53552097 TAGCATCAGGATCAGAGTGAGGG + Intergenic
1175729646 20:61345697-61345719 TCCATTCAGGATCTCAGTGCAGG - Intronic
1176666425 21:9691448-9691470 TCCCTTAAGAATCAGAGCCCCGG - Intergenic
1180987657 22:19914883-19914905 TCCCTTCAGCCTCAGAATGTTGG - Intronic
1184827384 22:46962067-46962089 TCCCCCCAGGACCAGAGGGCCGG - Intronic
949567144 3:5255402-5255424 GGCCTTCAGGATCTGAGAGCGGG - Intergenic
949909398 3:8888672-8888694 TACCTCCAGGATCAGAATCCAGG - Intronic
952560932 3:34592636-34592658 TCCTTTCAGGATCAGTGAGAAGG + Intergenic
953479294 3:43236208-43236230 TCACTTCAGAGTCAGAGTGAGGG + Intergenic
953679866 3:45031007-45031029 TCCGTTCAGCATCAGGGTCCTGG + Intronic
953996349 3:47522858-47522880 GCCCTGCAGGAACAGAGAGCTGG - Intergenic
954535936 3:51359244-51359266 TCCCTCCAGGCTCCCAGTGCAGG + Intronic
954821110 3:53328209-53328231 GCCCTTCAGGTTCAGTGTGCTGG - Intronic
955932171 3:64068033-64068055 TCCCTGGAGGAGCAGAGTGGAGG + Intergenic
961009113 3:123424295-123424317 TCCTTTCATGAGCAGAGTCCTGG + Intronic
962916547 3:139909451-139909473 TCCCTCCAGGATCTCAGAGCTGG - Intergenic
964894556 3:161579614-161579636 TCCCTTGAGTCTCAGAGTTCTGG - Intergenic
967201170 3:187073884-187073906 AGGCTTCAGGATCAGAGTCCGGG - Intronic
969925711 4:10583949-10583971 TCCCTCCAGGATGCCAGTGCAGG + Intronic
970802149 4:19985817-19985839 TCCCTGTAGAATCAGAGTGAAGG - Intergenic
975827082 4:78331323-78331345 TCAGTTCAGGAGCAGAGTCCTGG + Intronic
976469746 4:85414482-85414504 TGCCTTCTGGTTCTGAGTGCAGG + Intergenic
982028604 4:151277012-151277034 TCCCTTCAGGATCTGGCAGCGGG + Intronic
982275252 4:153631275-153631297 TCACTTCAGGTGCAGAGTGGGGG + Intronic
982602199 4:157466540-157466562 TTCCTTCAGGATTATAGTGCAGG - Intergenic
982696421 4:158607071-158607093 TGCCTTCATGTTCTGAGTGCAGG - Intronic
982705716 4:158706760-158706782 TCCCTTAAGGTTAAGTGTGCCGG - Exonic
985818436 5:2144027-2144049 TCCTTCCAGGGTCAGAGTGGTGG - Intergenic
986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG + Intronic
992173576 5:74127616-74127638 TCCCTCCAGGATCAGAGAGGGGG + Intergenic
993827860 5:92714711-92714733 GCCCCTGAGGCTCAGAGTGCTGG + Intergenic
995758624 5:115540247-115540269 AAGCTTCAGGATCAGAGTGGAGG + Intronic
998642211 5:144023697-144023719 TGCATTAAGGATCAGAGTGTTGG - Intergenic
1000718157 5:164672808-164672830 TAACTTCAGGTTCAGAGTGACGG + Intergenic
1001781271 5:174371043-174371065 TCCCTTCAGGATCACATCTCAGG + Intergenic
1001995189 5:176151867-176151889 CCCCTTCATGGTCAGAGTGTGGG - Intergenic
1001996503 5:176164601-176164623 CGGCTTCAGGATCAGAGAGCTGG + Intergenic
1003327186 6:5100813-5100835 GTCTTTCAGGATCAAAGTGCTGG + Intergenic
1003378991 6:5605340-5605362 TCCCTTCTAGATCAGAGGACAGG - Intronic
1003560851 6:7178538-7178560 TTCCTTCAGGACCACAGAGCAGG - Intronic
1004427755 6:15517648-15517670 CCCCTTCAGGCTGAGAGAGCTGG + Intronic
1006364408 6:33606943-33606965 TCCCTTCAGGGCCTGGGTGCTGG - Intergenic
1007424165 6:41735986-41736008 TCTCTTCAGGAGTAGGGTGCAGG + Intronic
1008813720 6:55537662-55537684 TGCCTGCAGTATCAGAGTGTTGG - Intronic
1011654376 6:89536476-89536498 TGCTTTCAGGCTCAGAGTGGTGG + Intronic
1018385641 6:163300480-163300502 TCCCTGCAGGAAGAGAGTGAGGG - Intronic
1018433502 6:163741976-163741998 TCCCTTCTGCATGAGCGTGCTGG + Intergenic
1019403029 7:867207-867229 TGCCCTCAGGAGCAAAGTGCTGG - Intronic
1022622521 7:31999517-31999539 TGGCTTCAGGGTCAGAGAGCTGG - Intronic
1032587026 7:133156379-133156401 TCCCTTGAGTATCAGAGCCCGGG - Intergenic
1035090564 7:156306622-156306644 TCCCTCCAGGGTCAGAGAGGAGG + Intergenic
1035298067 7:157878039-157878061 GCCCTTCAGAGTCAGAGAGCCGG - Intronic
1035969975 8:4237239-4237261 TCTCTTCAGGACCAAAGGGCAGG - Intronic
1036917904 8:12821978-12822000 GCACTTCCGTATCAGAGTGCAGG + Intergenic
1037690228 8:21175714-21175736 TTTCTTCATGATCAGAGTGAGGG + Intergenic
1037898112 8:22671744-22671766 TACCTTCAGGCTCAGACTTCTGG - Intergenic
1041871818 8:62643503-62643525 TCCCAGCATGATCAGAGGGCAGG - Intronic
1042548694 8:69973975-69973997 TCCCATCAGGAGCAGAGAACAGG - Intergenic
1043744583 8:83857882-83857904 TCCCTTTATAATCATAGTGCAGG - Intergenic
1046138524 8:110061394-110061416 TGCCATCAGAAACAGAGTGCTGG - Intergenic
1047068711 8:121317625-121317647 TCATTTGAAGATCAGAGTGCTGG + Intergenic
1049056084 8:140238794-140238816 TCCCTGCCTGATCAGAGAGCTGG + Intronic
1049353656 8:142177359-142177381 TCTCTTCAGGGTCAGAGGGTCGG - Intergenic
1049667658 8:143853792-143853814 TCCCTCCAGCATCTGAGTCCTGG - Intergenic
1050963153 9:11763778-11763800 TTCATTCAGGATCAGAGTCAAGG - Intergenic
1056224571 9:84482653-84482675 TCCCTGCAGGTCCAGAGTGAGGG - Intergenic
1059297330 9:113283261-113283283 TCCTCTCAGGAACTGAGTGCTGG + Intronic
1061321352 9:129831960-129831982 TCCCTCCAGGATCAGTGAGGAGG - Exonic
1062151099 9:135019468-135019490 TCCTTGCAGGAGCAGAGGGCAGG - Intergenic
1203659676 Un_KI270753v1:30313-30335 TCCCTTAAGAATCAGAGCCCCGG + Intergenic
1186173167 X:6898902-6898924 TCTCTTCAGTATAAGAGTCCAGG + Intergenic
1189282113 X:39826237-39826259 TCCCTAAAGGGTCACAGTGCAGG - Intergenic
1195411002 X:104567576-104567598 TACCTTCAGGCTCTCAGTGCAGG - Intronic
1196682399 X:118482553-118482575 TCCCTTGAGGACAAGAGTTCAGG - Intergenic