ID: 986702722

View in Genome Browser
Species Human (GRCh38)
Location 5:10427302-10427324
Sequence CATTGTGCCCAGTGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986702722_986702725 14 Left 986702722 5:10427302-10427324 CCTTCTCCACACTGGGCACAATG 0: 1
1: 0
2: 0
3: 22
4: 257
Right 986702725 5:10427339-10427361 TGAATCTCATTGTACCTCTTTGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986702722 Original CRISPR CATTGTGCCCAGTGTGGAGA AGG (reversed) Intronic
903356257 1:22749646-22749668 TATTGGGCCCAGGATGGAGAGGG + Intronic
905524468 1:38625735-38625757 CATGGTCCCCACTGTGGAGCAGG - Intergenic
905649790 1:39648504-39648526 CATTGGGCCCAGAGTAAAGATGG + Intergenic
907111862 1:51934028-51934050 CTCTCTGCCCAGTGAGGAGAGGG - Intronic
911334117 1:96560655-96560677 CATGGTGCTGAGTGAGGAGATGG - Intergenic
911436253 1:97862601-97862623 CAGTGTGCACAGTGTAGATAAGG - Intronic
911793341 1:102046450-102046472 CATGTTGCCCAGGGTGAAGACGG + Intergenic
913010757 1:114681304-114681326 CACTGTGCCCAGCCTGGAAACGG - Intronic
913071893 1:115306902-115306924 CATAGTGCCCAGTGGTGATAGGG - Intronic
915068573 1:153246437-153246459 AATTGTGCCCAGTAGGGAGCAGG - Intergenic
915282663 1:154833226-154833248 GATTTTGCCCAGTGTGGGGATGG - Intronic
915524275 1:156466618-156466640 CATTGGGGCGAGTGTGGTGAGGG - Exonic
915978993 1:160408581-160408603 CACTCAGCCCAGTGAGGAGAAGG + Intronic
919640349 1:200039713-200039735 CATGCTGCCCAAAGTGGAGACGG + Exonic
919975060 1:202605010-202605032 CCTTGTGCCAAGTCTTGAGAGGG + Intronic
920039071 1:203084390-203084412 CATTGTCCTCTCTGTGGAGAAGG + Intronic
920193533 1:204211168-204211190 CTTTGAGCGCCGTGTGGAGAAGG - Intronic
922553920 1:226518773-226518795 AAATTAGCCCAGTGTGGAGAGGG + Intergenic
922696054 1:227731641-227731663 CATCATACCCAGTGTGAAGAGGG + Exonic
922754254 1:228086038-228086060 CAATTTTCCCAGAGTGGAGAGGG + Intronic
923044139 1:230342896-230342918 CATTGTGACCAGTGTGGCTGCGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923539015 1:234875012-234875034 AATTATGCCCACTGTGGAAACGG - Intergenic
924585166 1:245355392-245355414 CATGTTGCCCAGGCTGGAGATGG - Intronic
1064316701 10:14264163-14264185 CATTATGCCCAGTTCAGAGATGG + Intronic
1066013966 10:31219444-31219466 CATTCTGCTCATTTTGGAGATGG + Intergenic
1067112774 10:43412144-43412166 AAGTGAGCCCAGTGTGGAAAAGG - Intergenic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1070888486 10:79924907-79924929 CTTTATGCACAGTGTGGAAAAGG - Intergenic
1072677139 10:97476170-97476192 AATTGTGCACAGTGTACAGAAGG - Intronic
1072826349 10:98610628-98610650 CACTGTGCCCACTGTGGAAAAGG + Intronic
1074594265 10:114846163-114846185 CATTGTGCTCAGTTCTGAGATGG + Exonic
1075632954 10:124012128-124012150 CATTGTGCACAGTATGGTGAGGG - Intronic
1075928740 10:126274818-126274840 AAATGTAACCAGTGTGGAGATGG - Intronic
1076346592 10:129783115-129783137 CTTTGTCCACAGTGTAGAGAAGG + Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869234 10:133185312-133185334 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869238 10:133185358-133185380 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869240 10:133185381-133185403 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1077899659 11:6478489-6478511 CATTCTCCCCAGTGCAGAGAGGG + Intronic
1078399449 11:11011101-11011123 CTCTGTGCCCAGCCTGGAGAGGG + Intergenic
1079373912 11:19874866-19874888 CATTGTGCCCAGTCTGCAACTGG - Intronic
1079833013 11:25294742-25294764 CATTGTTTCCAATCTGGAGAAGG - Intergenic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1083492485 11:63023132-63023154 CATTGTCCCCATTTTGCAGATGG - Intergenic
1083778750 11:64907291-64907313 CACTGTCACCAGTGTAGAGAAGG + Exonic
1085465239 11:76719263-76719285 CCATGTGCCCATGGTGGAGATGG + Intergenic
1085584581 11:77689873-77689895 CACTGTGCCCAGCCTGGAGAAGG - Intronic
1085762622 11:79255269-79255291 CATGGTGCCCAGTGCACAGAAGG + Intronic
1085795126 11:79532442-79532464 CACTGTGCCCAGTCTGGTGAAGG + Intergenic
1087026899 11:93659055-93659077 TATTGTGGCTAGTTTGGAGAGGG - Intergenic
1090225020 11:125064520-125064542 CATTTTGCCCAGGATTGAGAGGG - Intronic
1090908483 11:131097560-131097582 CACTGTGCCCAGTGCTGAGTTGG + Intergenic
1091795528 12:3295574-3295596 CCTGCTGCCCAGGGTGGAGATGG - Intergenic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1093591438 12:20906327-20906349 CTTGGGGCTCAGTGTGGAGAAGG + Intronic
1094590331 12:31813668-31813690 CACTGTGCCCGGCCTGGAGAGGG - Intergenic
1097031679 12:56094420-56094442 CAATGTGCCCATTTTCGAGATGG + Exonic
1098595686 12:72271949-72271971 TAAAGTGCCCAGGGTGGAGAAGG + Intronic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1099848254 12:88057589-88057611 AATTTTTCCCAGTGTGTAGATGG + Intronic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1101945031 12:109130140-109130162 CATGGTGCTCTGAGTGGAGATGG + Intronic
1103711787 12:122918143-122918165 CCTTGGGCTCAGTGTGGAGAAGG - Intergenic
1104536358 12:129621490-129621512 CATTTTGGCCAGTGGGGATATGG - Intronic
1104763590 12:131312835-131312857 CATCCTGCCCACTGTGCAGATGG + Intergenic
1104815910 12:131645242-131645264 CATCCTGCCCACTGTGCAGATGG - Intergenic
1104971091 12:132530980-132531002 CCTTGTGTCCAGTGTGGGGGGGG + Intronic
1106017223 13:25881167-25881189 CATTCTACCAAGTGTGGAAAAGG - Intronic
1106813472 13:33382381-33382403 CGATCTGCCCAGTGTGGGGAGGG - Intergenic
1110516020 13:76413253-76413275 CATTGTGGTCAGTCTGGGGAAGG - Intergenic
1111983593 13:95042374-95042396 CATTGTGCATGGTGTAGAGAGGG + Intronic
1112446410 13:99468573-99468595 CTTTGTGCCAAGTATTGAGATGG + Intergenic
1114513337 14:23280371-23280393 CCTTCTGCCCTGTGTGGAGGGGG - Intronic
1117575440 14:57092635-57092657 CAGTGTGATCACTGTGGAGATGG + Intergenic
1120968448 14:90187823-90187845 CATTGTGCCCCATGTGGAAATGG + Intergenic
1121487022 14:94324299-94324321 GATTGATCACAGTGTGGAGAAGG + Intergenic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1122324626 14:100874960-100874982 CTTTGTGCCCAGGGTGGAGGGGG + Intergenic
1125109630 15:36015605-36015627 TATGGTGGCCAGTCTGGAGATGG + Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1126643341 15:50850675-50850697 CCTTGTGCCCTGGGTTGAGAGGG + Intergenic
1126826243 15:52552279-52552301 CACTGTGCCCAGTCTGAAGGGGG - Intronic
1127292049 15:57579769-57579791 ATTTGTCCTCAGTGTGGAGAAGG - Intergenic
1127838598 15:62810544-62810566 TAGTGTGCCTAGTGTGGAGCTGG + Intronic
1128990692 15:72257384-72257406 CATGACGCCCAGTGTGTAGAAGG + Exonic
1129109240 15:73328111-73328133 CAGAGTGCCGAGTGTGGTGAAGG + Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1133820396 16:9231259-9231281 CAGTGAGCCCAGTGTGGTGGGGG - Intergenic
1134125630 16:11614040-11614062 CGTTGTGCCCATTGTACAGACGG + Intronic
1134602040 16:15541221-15541243 CATTGGGCAAGGTGTGGAGAGGG + Intronic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1135270226 16:21062974-21062996 CATTGCACCCAGCTTGGAGATGG + Intronic
1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG + Intronic
1138431735 16:56973223-56973245 CATTCAGCCCAGAGTGCAGATGG - Intronic
1138535372 16:57657235-57657257 CATTCTGCTCAGTTGGGAGAGGG + Intronic
1139278439 16:65749456-65749478 CAATGTTCACAGGGTGGAGAGGG - Intergenic
1139658771 16:68405802-68405824 AATTGTACCCAGTGAGGAGGGGG - Intronic
1140228223 16:73096030-73096052 GATTGAGCCAAGGGTGGAGAGGG + Intergenic
1141287397 16:82685319-82685341 CATTCTGCCAAGTGAGGACACGG - Intronic
1141706379 16:85667428-85667450 CATTGTGCCCCGTTTCAAGAGGG - Intronic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143096709 17:4482207-4482229 GATTCTCCCCATTGTGGAGATGG - Intronic
1143301408 17:5913282-5913304 CATTTGGAGCAGTGTGGAGAGGG + Intronic
1144405499 17:14949107-14949129 CATTGGGCAAAGTGTGGAGAAGG - Intergenic
1146679415 17:34796334-34796356 CACTGTGCCCAGTGGAGGGATGG - Intergenic
1147326447 17:39672029-39672051 CTAGGTGCGCAGTGTGGAGACGG - Exonic
1147672671 17:42185571-42185593 CCTTGGGCCCAGCCTGGAGACGG - Intergenic
1147914808 17:43879913-43879935 CTTTGTGTCCCGTGGGGAGATGG - Exonic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1151034809 17:70786390-70786412 CATTTTTTCCATTGTGGAGATGG + Intergenic
1151290430 17:73146039-73146061 CATTTTGCCCTGAATGGAGACGG - Intergenic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1152595976 17:81237834-81237856 CATAGTCCCCTGTGTGGAAAAGG - Intronic
1152719145 17:81914383-81914405 CATTGTGCACTTTGGGGAGAGGG - Exonic
1154380965 18:13849484-13849506 CACTGTGCCCAGCCAGGAGAAGG - Intergenic
1155927556 18:31673206-31673228 CAATCTGCCCTGAGTGGAGATGG + Intronic
1158841464 18:61392577-61392599 CCTTGTGCTCAGCATGGAGAGGG - Intronic
1158872687 18:61703489-61703511 CAGGGTGCCGAGTGAGGAGATGG - Intergenic
1162474807 19:10893637-10893659 CATTGTGCCCATTTTATAGATGG + Intronic
1164569047 19:29356247-29356269 TATTGTGCCCACTTGGGAGAGGG - Intergenic
1165308052 19:35014111-35014133 CCTTGTGGCCAGTGTGGACTTGG + Intronic
1165977704 19:39691769-39691791 CATTCTGCACAGTGGAGAGAAGG + Intergenic
1166103361 19:40584226-40584248 CATTCTGCCCCTAGTGGAGAGGG - Intronic
1167291794 19:48628875-48628897 CACCGTGCCCAGTGTGAAGCGGG - Exonic
1168122028 19:54256910-54256932 CCTTGTCCCCAGTGAGAAGAAGG + Intronic
1168125472 19:54280213-54280235 CCTTGTCCCCAGTGAGGAGGAGG + Intronic
1168171782 19:54594505-54594527 CCTTGTCCCCAGTGAGGAGGAGG - Intronic
1168176503 19:54631335-54631357 CCTTGTCCCCAGTGAGGAGGAGG - Intronic
1168501882 19:56899780-56899802 CATGGTGCACAGTGGGGAGCCGG + Intergenic
927192118 2:20524048-20524070 GATTATGCCCAGTGTGCAGAAGG - Intergenic
928101349 2:28439382-28439404 CATGGTTCCCAATTTGGAGATGG - Intergenic
930251686 2:49041856-49041878 CATTGTGCCCAGCCTGGTTAAGG - Intronic
930730517 2:54723971-54723993 CCCTGAGCCCAGCGTGGAGAGGG - Intronic
932138365 2:69252014-69252036 AATTCTGCCCAGAGTGGGGAAGG - Intergenic
932818981 2:74883436-74883458 CAGGCTGCCCATTGTGGAGAGGG + Intronic
937228700 2:120384495-120384517 CAGACTGCCCAATGTGGAGAAGG - Intergenic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938220382 2:129561163-129561185 CATGGTGAACAGTCTGGAGAAGG + Intergenic
939463470 2:142527593-142527615 CATGGTGCCCAGCCTGGATATGG - Intergenic
940510179 2:154603893-154603915 CCTTGTGGCCACTGTGGGGATGG + Intergenic
946013812 2:216588092-216588114 CCTTCTGCCCAGTGTGTTGATGG + Intergenic
947915762 2:233830778-233830800 CCTTGTGCCCAGGGTGGCCAGGG - Intronic
948308560 2:236968425-236968447 CCTTGAGCCCAGGGTTGAGAGGG + Intergenic
948494311 2:238337020-238337042 CCTTCTGGCCAGGGTGGAGAGGG + Intronic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1172293781 20:33793621-33793643 CAGTGTCCCTCGTGTGGAGAAGG - Intergenic
1172605126 20:36208856-36208878 CATGGAGCCCAGGGTGGAGCTGG + Intronic
1172719190 20:36986222-36986244 CATCTTGCCCAGGGTGAAGAGGG + Intergenic
1172774634 20:37399934-37399956 CATTGTACCCATTGTACAGATGG + Intronic
1174463667 20:50700697-50700719 CCTTGTGCCTAGAGTGGAGGGGG + Intergenic
1174556664 20:51400444-51400466 CATGGTGCCCAGTGTTAATATGG + Intronic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175698988 20:61123753-61123775 CCATGGGCACAGTGTGGAGAAGG + Intergenic
1175823186 20:61923082-61923104 CTTTGAGCCTAGTGTGGGGAAGG - Intronic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1181022470 22:20110736-20110758 CATCGTGTCCAGACTGGAGAGGG - Exonic
1181023627 22:20115883-20115905 CATTGTGCCCACTGTGACGTGGG + Intronic
1181620833 22:24090146-24090168 CATTGTGCCCTGTATGGGGAAGG + Intronic
1182011809 22:27007298-27007320 CATTGTGGCCATTGTGGATGTGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1184714999 22:46276396-46276418 CACTGTGCCCAGTCTCGTGAAGG - Intronic
1184760760 22:46542774-46542796 CAGAGTGCACAGCGTGGAGATGG + Intergenic
1185058825 22:48594992-48595014 CTATGTGCCCCGTGTGGACAGGG - Intronic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950212857 3:11136698-11136720 CATTGTTCCCATTTTTGAGATGG + Intergenic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
950788388 3:15453904-15453926 CACCGTGCCTACTGTGGAGATGG - Exonic
951226085 3:20122931-20122953 CCTGGTGGTCAGTGTGGAGAGGG + Intronic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
952069741 3:29619618-29619640 CATTGTACCCATTGTATAGATGG - Intronic
952503067 3:33982184-33982206 CAATGAGCTCAGTGTGGAGCAGG - Intergenic
954682179 3:52351684-52351706 CAAGGTGCCCAGTGTAGTGATGG - Intronic
955087957 3:55721227-55721249 CATTATGCCCACTTTGCAGATGG - Intronic
955372051 3:58360545-58360567 CACTGTGCCCAGCCTGGAGCTGG - Intronic
957880282 3:86203307-86203329 CAATGTGCCCATAGTGGAGGGGG + Intergenic
958753638 3:98223917-98223939 CACAGTGCCCAGTGAGTAGAGGG + Intergenic
958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG + Intergenic
962317260 3:134366721-134366743 CCCTGTGCCCAGTGTCCAGAAGG + Intronic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
964602732 3:158519932-158519954 AATTGTGACCAGTGAGGAAAAGG + Intronic
964779082 3:160315283-160315305 CATTGTCTCCAGTGAGCAGAGGG + Intronic
965673216 3:171168435-171168457 CATTGTGTTCTGTGTGGTGAGGG - Intronic
966619455 3:181947790-181947812 CATTGTTCACAGTGTGAACAGGG - Intergenic
967159480 3:186722741-186722763 CATTGTACCCAGTGTGTGCAAGG + Intronic
967416359 3:189223036-189223058 CATTGTGCACTTTGTGAAGAAGG + Intronic
968631250 4:1653293-1653315 CATGGGGCTCAGTGTGGACATGG - Intronic
972458844 4:39280368-39280390 CATTGTGCCCAGCCTGGCAATGG - Intronic
981339364 4:143602935-143602957 TATTTTGCCCAGGATGGAGATGG + Intronic
985287814 4:188354740-188354762 CACTGTGCCCATTGGGGAGGGGG + Intergenic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
988502530 5:31795526-31795548 AATTGTGCTCACTGTTGAGATGG + Intronic
989101568 5:37828163-37828185 CATTCTGCCCAGCGAGGGGATGG - Intronic
989624663 5:43417745-43417767 CATTTTGCCCAGTGCAGAGATGG - Intergenic
991220561 5:64210888-64210910 CAAGGTGTCCAGTGAGGAGATGG + Intronic
992371964 5:76152785-76152807 TAGTGTGCCCAGTGTTGGGAGGG - Intronic
992773971 5:80073670-80073692 CACTGTGCCCAGCCCGGAGAGGG + Intronic
995198288 5:109398105-109398127 CATTCTGACTGGTGTGGAGATGG - Intronic
995397798 5:111706438-111706460 CAGTTTGTCCAGGGTGGAGATGG + Intronic
997139636 5:131364876-131364898 CAGTGTGCTCAGTGTTTAGATGG + Intronic
997933219 5:138088994-138089016 CTTTGTGGACAGTTTGGAGAAGG + Exonic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1005117996 6:22359453-22359475 AATTGTGACAAGTGTTGAGAGGG + Intergenic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1007091129 6:39185566-39185588 CTGGGAGCCCAGTGTGGAGAGGG - Intergenic
1009061856 6:58406098-58406120 CATTGTGGCCAATGTGAAAAAGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010945675 6:81970533-81970555 CATTTTGTCCATTGTGGAGAGGG - Intergenic
1012566541 6:100662950-100662972 CATTGTGGCTAGTGTGGATGAGG - Intronic
1013376181 6:109517074-109517096 CAGTGTGCTCAATGTGGAGCGGG + Intronic
1013846568 6:114459947-114459969 CATTATGCCTATTGTGCAGATGG - Intergenic
1014892089 6:126855157-126855179 CATAGTGCCAAATGAGGAGACGG - Intergenic
1015120915 6:129700753-129700775 TATTATTCCCAGTGTGCAGAAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018330633 6:162724253-162724275 CTTTGTGGAAAGTGTGGAGAAGG - Intronic
1018435758 6:163757516-163757538 CAATGAAGCCAGTGTGGAGAAGG - Intergenic
1020336193 7:7064138-7064160 CATTGTTCCTAATATGGAGAGGG + Intergenic
1020695294 7:11406455-11406477 CAGGAGGCCCAGTGTGGAGAAGG - Exonic
1021111328 7:16697892-16697914 TATTGTGCCCAATGGGGTGAGGG - Intronic
1022623665 7:32011669-32011691 GATTGTGCCAAGTGTTGACAAGG + Intronic
1023394880 7:39743518-39743540 AATACTGCCCAGTGTGGGGAAGG + Intergenic
1024392514 7:48831710-48831732 CATGGTGGCCAGTGGGGAGATGG - Intergenic
1026565735 7:71488411-71488433 CATTCTGCTCACTGTGCAGAAGG - Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1028226302 7:88255929-88255951 CCTTGAGCCCAGTTTGGGGAGGG - Intergenic
1029597717 7:101546562-101546584 CACTGTGCCCAGCCTGGGGAAGG + Intronic
1031288233 7:119899941-119899963 TGTAGTTCCCAGTGTGGAGAAGG - Intergenic
1034202263 7:149289998-149290020 CAGCCTGCCCAGTGCGGAGAGGG + Intronic
1035382774 7:158450284-158450306 CATTGAACTCAGTGTGTAGAAGG - Intronic
1035719012 8:1777097-1777119 CATAGAGCCGAGTGTGGAGTTGG - Intronic
1037955862 8:23057956-23057978 CATTGTGCCCAGCCAAGAGATGG - Intronic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1041080943 8:54214357-54214379 CATTCTTCCCAGTGTGCTGATGG + Intergenic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1044543442 8:93432985-93433007 CATTGTGCTCAGTATGGATTTGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1047768337 8:128008729-128008751 CATTGTGCCCAGCATGGTCAGGG - Intergenic
1048198589 8:132352880-132352902 CATCATGCCCAGTGTGGAACTGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1049493182 8:142915677-142915699 CACTGTGCCCAGGGCGGGGAAGG - Intronic
1049739902 8:144233694-144233716 CAATATTCCCTGTGTGGAGATGG + Intronic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1053825463 9:42018833-42018855 CATTCTCCCCAGTGTTCAGAGGG - Intronic
1054605101 9:67168524-67168546 CATTCTCCCCAGTGTTCAGAGGG + Intergenic
1056589851 9:87958094-87958116 CGTTGTGGCCAGTGTGGTCACGG + Intergenic
1057171358 9:92965130-92965152 GATTGTGCCCACTGTGCAGAGGG + Intronic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059540294 9:115123640-115123662 CATTGTTCCCATTTTGCAGATGG + Intergenic
1060687728 9:125626542-125626564 AAATGTGGCCAGTGTGGTGATGG - Intronic
1061618955 9:131798489-131798511 CAGCCTGCCCAGGGTGGAGAAGG + Intergenic
1061894355 9:133639462-133639484 CATTGTTCCCAGTCTTGAGGAGG + Intronic
1062040797 9:134403434-134403456 CATGGTGCCCTGTGGCGAGAGGG + Intronic
1062218505 9:135402128-135402150 CCTTGGGCTCAGTGTGGAGCAGG - Intergenic
1062490382 9:136802517-136802539 CGTTGTGCCCAGCGGGGAGTGGG + Intronic
1186435560 X:9540094-9540116 CTCTGTCCCCAGTGTGGATAGGG - Intronic
1187276422 X:17820061-17820083 TACTGAGCCCAGTGTGGAGAGGG + Intronic
1189259926 X:39671026-39671048 CAGTGTGACTAGTTTGGAGATGG + Intergenic
1190109263 X:47579429-47579451 CATTGTGCTCTTTGTGCAGATGG - Intronic
1190431567 X:50382709-50382731 GTTAGTGCCCAGTGTGGAGGGGG - Intronic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1195852712 X:109300626-109300648 AATTGTGCCCAAAGTGGAGGAGG + Intergenic
1195957605 X:110349353-110349375 CAATGTGCTCAGTGTGGTGCAGG + Intronic
1195989103 X:110665249-110665271 CATTCTGGCAAGTTTGGAGAGGG - Intergenic
1197136041 X:123060742-123060764 GATTGTGACCAGTGCAGAGATGG - Intergenic
1197829849 X:130630033-130630055 CATTATGCCCATTTTGCAGATGG + Intronic
1199384037 X:147203277-147203299 CATTTAAACCAGTGTGGAGAGGG + Intergenic
1201700401 Y:16875141-16875163 CATTGTGCCATATGTGGAAATGG + Intergenic