ID: 986703913

View in Genome Browser
Species Human (GRCh38)
Location 5:10439826-10439848
Sequence CAGGGTGAACACAGAGGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986703913_986703922 13 Left 986703913 5:10439826-10439848 CCATCACCTCTGTGTTCACCCTG 0: 1
1: 0
2: 3
3: 36
4: 349
Right 986703922 5:10439862-10439884 CCCTGCCTCCAAAACAGGTCAGG 0: 1
1: 0
2: 1
3: 18
4: 196
986703913_986703919 8 Left 986703913 5:10439826-10439848 CCATCACCTCTGTGTTCACCCTG 0: 1
1: 0
2: 3
3: 36
4: 349
Right 986703919 5:10439857-10439879 GTCCTCCCTGCCTCCAAAACAGG 0: 1
1: 0
2: 6
3: 31
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986703913 Original CRISPR CAGGGTGAACACAGAGGTGA TGG (reversed) Exonic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900133627 1:1103561-1103583 CAGGGTGCACGCAGGGGTCAGGG + Intronic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
900704861 1:4074052-4074074 GCGGGTGAAGACAGAGGTGCTGG - Intergenic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
902707558 1:18216185-18216207 CTAGGTGAACTCAGAGGAGAAGG + Intronic
903269142 1:22176970-22176992 CAGGGTGAGCCCAGAGGACATGG + Intergenic
903623631 1:24715635-24715657 CAGCCTGAACACTGAGGTCATGG - Intergenic
905328706 1:37176693-37176715 AAGGCTGAGCACAGAGCTGATGG + Intergenic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
906938653 1:50236569-50236591 CAGGGAGGCCACTGAGGTGAAGG - Intergenic
907927662 1:58969562-58969584 TAGGGTTAACACCTAGGTGAAGG + Intergenic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
910551581 1:88481454-88481476 CAGGTAGAACACTGAGGTCAAGG - Intergenic
913359602 1:117965377-117965399 CATCGTTTACACAGAGGTGATGG - Exonic
915864671 1:159486223-159486245 CAGTGTGAACACAAAGGTGAAGG + Intergenic
917580643 1:176374406-176374428 CTTGGTGAACACAGACATGAAGG + Intergenic
917672114 1:177282711-177282733 CAGGGAGAAAAAAAAGGTGATGG - Intergenic
917716398 1:177742065-177742087 CAGTGTCACCACAGTGGTGATGG + Intergenic
918139729 1:181710154-181710176 CAGAGGGAACACTCAGGTGAAGG - Intronic
920254073 1:204642485-204642507 CAGGATGAACCCAAATGTGAGGG - Intronic
923761109 1:236845057-236845079 CAGAGTGACCACCGAGGTGGCGG + Intronic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
924786933 1:247207551-247207573 CTTGGAGAACACAGAGCTGAAGG - Intergenic
1063657396 10:8005681-8005703 CTGGTTGAACACACAAGTGATGG - Intronic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1066588178 10:36961199-36961221 AAGTGTAAAGACAGAGGTGAAGG + Intergenic
1067945898 10:50687734-50687756 CAGGTGGGACACAGAGGTGGAGG - Intergenic
1068310156 10:55265048-55265070 CAGGGTGGACCCAGAGGAGCAGG - Intronic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1070867414 10:79714610-79714632 CAGGTGGGACACAGAGGTGGAGG - Intronic
1070881206 10:79852734-79852756 CAGGTGGGACACAGAGGTGGAGG - Intergenic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071634328 10:87236833-87236855 CAGGTGGGACACAGAGGTGGAGG - Intronic
1071647779 10:87369050-87369072 CAGGTGGGACACAGAGGTGGAGG - Intronic
1072411760 10:95209223-95209245 CAGAGGGAACTCAGAGGTAAAGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073657585 10:105434165-105434187 CAGGGAGTACAAAGAGATGAGGG - Intergenic
1076008682 10:126969096-126969118 CATGGTGAACACTCAGGTAACGG - Intronic
1076411863 10:130257318-130257340 CAGGGTGAACACAGAGCCTGAGG - Intergenic
1076495870 10:130897594-130897616 CAGGTGGAACAGAGAGCTGAAGG - Intergenic
1076854318 10:133108474-133108496 CAGGGAGGAGACAGAGGTGTTGG + Intronic
1077486185 11:2839333-2839355 CAGGGTGGGGACAGAGGTCATGG - Intronic
1077619051 11:3702735-3702757 CATTGTGAACACAGAAGTCAGGG + Exonic
1077961418 11:7080033-7080055 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1078000524 11:7491209-7491231 GAGGGTGAGGATAGAGGTGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078063687 11:8064211-8064233 CAGGGAGAAGACTGAGATGAAGG + Intronic
1078897184 11:15607106-15607128 TTGGATGAAGACAGAGGTGAAGG - Intergenic
1079130378 11:17743788-17743810 CAGGGAGGACACTGAAGTGAGGG - Intronic
1082916010 11:58438213-58438235 CAAGGTTACCACAGAGCTGATGG - Intergenic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1083692051 11:64415377-64415399 CAGGGAGGACGCAGAGCTGACGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084974208 11:72787712-72787734 CAGCCTGAGCACAGAGCTGAAGG - Intronic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1086762718 11:90653189-90653211 GTGGGTGAACACAGGAGTGATGG - Intergenic
1086960744 11:92978134-92978156 GAGGGTGAGCACAGAGGAGGGGG + Intronic
1087179556 11:95128426-95128448 CAGGCTGTTCACAGAGGTGATGG - Exonic
1087441251 11:98185706-98185728 CAGAGTGAACACCGAGGCCAAGG + Intergenic
1088340241 11:108757181-108757203 AAGGAAGAAGACAGAGGTGAAGG - Intronic
1089174718 11:116540209-116540231 AAGGGTGAAGCCAGAGGAGAGGG - Intergenic
1089354307 11:117839918-117839940 CTGGGGGAGCAAAGAGGTGACGG + Intronic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090056782 11:123430765-123430787 CAGGGGGAGCGCAGAGGCGACGG + Exonic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090525512 11:127530410-127530432 CAGGCTGAATACGTAGGTGATGG - Intergenic
1090569713 11:128032829-128032851 CATGGGGCACAGAGAGGTGACGG + Intergenic
1091025224 11:132135730-132135752 CAGGGAGCACACAGAAATGATGG + Intronic
1091193138 11:133710959-133710981 CAGGGAGGTCACAGAGGGGAGGG - Intergenic
1091602953 12:1928972-1928994 CAGGGGTGATACAGAGGTGAGGG + Intergenic
1093444079 12:19234383-19234405 CAGGGAAAACACAGTTGTGAAGG - Intronic
1095962705 12:47845312-47845334 CAGAGGGAGCACAGATGTGAAGG - Intronic
1096621429 12:52867996-52868018 CAGGGGGAACTGAGAGGTGGGGG + Intergenic
1098398096 12:70043628-70043650 CTGGGAGAACACTGAGGTGGAGG + Intergenic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1100113126 12:91269793-91269815 AAGAGGGAACCCAGAGGTGAAGG - Intergenic
1100602420 12:96123123-96123145 CAAGGAGAAGCCAGAGGTGATGG + Intergenic
1101858307 12:108462692-108462714 CATCGTGATCACAGAGGAGAAGG - Intergenic
1102187239 12:110958371-110958393 CAGGGTGGAGACTGAGGTGAGGG - Intergenic
1102953047 12:117042640-117042662 CAGGGAGGACGCAGAGGCGATGG - Intronic
1103919929 12:124394034-124394056 CGGGGCGAAGACAGAGGTGGCGG + Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104346277 12:128002074-128002096 AGGGGTGCACACAGAGATGAGGG + Intergenic
1104935059 12:132360093-132360115 CAGGGTGTCCCCAGAGGAGAAGG + Intergenic
1104974282 12:132545554-132545576 CAGGCTGACCACACAGGCGAGGG - Intronic
1106123076 13:26878010-26878032 CAGGGTGAACTGAATGGTGAAGG + Intergenic
1106512602 13:30424194-30424216 CAGAGTGAAGGCAGAGGTGGGGG - Intergenic
1107587830 13:41871052-41871074 CAGGGTTGAGACAGAGGTAAGGG - Intronic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1110679386 13:78290530-78290552 CAGAGTGAATAAAGAAGTGAAGG - Intergenic
1112214609 13:97417376-97417398 CAGGGTGGAGAATGAGGTGAAGG - Intergenic
1113334501 13:109365169-109365191 CAAGCTGAACAGAGAGGAGACGG - Intergenic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1114875806 14:26716331-26716353 GAGGATGAACACAGATGTAAAGG + Intergenic
1115806961 14:37062657-37062679 CAGGGTGAACACTAAAGTCAAGG + Intronic
1115888800 14:38004225-38004247 CAGGCAGAACACAGAAGTCATGG + Intronic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116773483 14:49153290-49153312 CGGAGAGAACACAGAGGTGAAGG - Intergenic
1117830324 14:59743715-59743737 CAGGGGAAACAAAGAGGTGAAGG - Intronic
1119162837 14:72467586-72467608 CAGTGGGATCAAAGAGGTGAAGG - Intronic
1120702901 14:87717496-87717518 CAGAGTGAACTGGGAGGTGAGGG - Intergenic
1120802675 14:88710055-88710077 CAGGGAGAATGGAGAGGTGAGGG - Intronic
1121154462 14:91669937-91669959 CAGGGTGCTCACAGAGGCAATGG + Exonic
1121227875 14:92334658-92334680 CATGGTGAAGGCAGACGTGAGGG + Intronic
1121526873 14:94625330-94625352 GAGTTTAAACACAGAGGTGATGG + Intergenic
1121724015 14:96132896-96132918 CAGGCTGAAGACACAGGAGAGGG + Intergenic
1122602572 14:102928972-102928994 CCGGGTGAGCACTGAGGGGAGGG + Exonic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1123876994 15:24633424-24633446 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1124258479 15:28165162-28165184 CTGGGTCAACATGGAGGTGAGGG + Intronic
1124566967 15:30824909-30824931 CAGGCTGTTCTCAGAGGTGATGG - Intergenic
1124654430 15:31497157-31497179 CAGGGGCCACACAGAGGTCAGGG - Intronic
1124859929 15:33429437-33429459 CAGCGGGAACACAAAGCTGAAGG + Intronic
1126382815 15:48066357-48066379 CAGGGGGAAGGCACAGGTGATGG - Intergenic
1127427117 15:58867468-58867490 CAGAGTCAGCACAGAGGTGCTGG - Intronic
1128249664 15:66155430-66155452 TGGGGTGCACACAGAGGTGAAGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1129318704 15:74761993-74762015 AGGGGTAAATACAGAGGTGAAGG - Intergenic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1129867687 15:78921988-78922010 CAGGCTGGGCACAGAGGTGAGGG + Exonic
1130147827 15:81288050-81288072 CAGAGAGGCCACAGAGGTGAGGG + Intronic
1130410558 15:83644741-83644763 GAGGGGGCACACAGAGATGATGG - Intergenic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132180161 15:99746647-99746669 CAGAGTGAAGACAGAAGAGAAGG + Intergenic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1133848566 16:9480123-9480145 GAGGGTGAGCACTGGGGTGATGG + Intergenic
1134117665 16:11561340-11561362 CAGAGTCAACACACAGGTGTGGG + Intronic
1134301761 16:12997811-12997833 ATGTGTGTACACAGAGGTGAAGG - Intronic
1136567659 16:31079819-31079841 CAGGGTGAAAGAAGAGGTGTGGG + Exonic
1140119701 16:72072949-72072971 CAGGGAGAACACAGAGAGTAAGG - Intronic
1140598320 16:76442564-76442586 CAGGGTCAAAACAGTGGAGAAGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141631972 16:85292822-85292844 CTGGGACCACACAGAGGTGACGG - Intergenic
1141656099 16:85417413-85417435 CAGGGAGAACACAGAGGCCAAGG - Intergenic
1141669503 16:85484472-85484494 CAGGGTGTACACAGCCGTGGCGG + Intergenic
1143206039 17:5139653-5139675 CAGGCTGAACACTGCGGAGAGGG + Exonic
1143661091 17:8325053-8325075 CAGGAAGAACACAGAAGGGAGGG - Intergenic
1144065844 17:11623383-11623405 CAGGGCAAACAAAGAGGTCAGGG - Intronic
1144640583 17:16934409-16934431 CAGGGAGGCCACAGAGGTCAGGG + Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146057009 17:29586497-29586519 CAGGATGAACACTCAGGTGCAGG + Intronic
1146464323 17:33074327-33074349 CAGGGCCAACACAGAAGGGAGGG - Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147917310 17:43896507-43896529 CAGGGAGAAAATGGAGGTGAAGG - Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1150656441 17:67042764-67042786 CACAGGGAACACAGAGGTGGGGG + Intergenic
1150937954 17:69658184-69658206 GAGGAAGAACACAGAGGTAAAGG + Intergenic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1152284769 17:79405892-79405914 CAGGGAAAACTCAGAGGTGGTGG - Intronic
1152531157 17:80920037-80920059 AAGGGTGAACAGAGAGGGCACGG - Intronic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1153160520 18:2199809-2199831 CAAGGTGAGTACAGAGGGGAAGG + Intergenic
1153448948 18:5205087-5205109 ATGGGTGAGCACAGAGGTGGAGG + Intergenic
1155676365 18:28434168-28434190 GAGGAAGACCACAGAGGTGAAGG + Intergenic
1155839827 18:30631095-30631117 CAGGGTGGACCCAGAGGAGCAGG + Intergenic
1156775565 18:40784007-40784029 TAGAGAGAACACAGAGATGAGGG - Intergenic
1157293602 18:46426498-46426520 CAGGGGGAACCCACAGGTGCTGG - Intronic
1157439211 18:47697193-47697215 CAGACAGGACACAGAGGTGAGGG - Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1159165665 18:64695996-64696018 GAGGAAGAACACAGAGGTGAAGG + Intergenic
1159840651 18:73394857-73394879 CAGGGAGAACACAGCTCTGATGG - Intergenic
1160144526 18:76352577-76352599 CAGGGTCAACACAGAGGACAAGG + Intergenic
1160421010 18:78744280-78744302 CAGTGTTCACACAGTGGTGAAGG + Intergenic
1160785941 19:900358-900380 TGGGGTGAACATACAGGTGAGGG - Intronic
1161097832 19:2403437-2403459 CAGGCTGAAAACAGAGGTTGTGG + Intronic
1161778069 19:6274675-6274697 CAGGGTGGTCCCAGAGGTGCAGG - Intronic
1163117493 19:15197405-15197427 CATGGTGAACACAGAGGCAGAGG + Intronic
1163311108 19:16515043-16515065 GAGGGTAAAAAAAGAGGTGAGGG - Intronic
1165360868 19:35336204-35336226 CCGGGTGAAGACAGACTTGATGG - Exonic
1165611127 19:37154107-37154129 CAGGCTGAACACAGAGAAAAGGG + Intronic
1166725596 19:45025465-45025487 CAGGGTGAGCACGGAAGTCAAGG - Intronic
1168701839 19:58444795-58444817 CAGGATGAAGACAAAAGTGAAGG - Intergenic
925402083 2:3582040-3582062 CAGGGTGAAGACAGCGGAAATGG - Intergenic
925781081 2:7382437-7382459 CAAGGAGAACTCAGGGGTGAGGG - Intergenic
925991642 2:9259606-9259628 CAAGGTGGAGACAGAGGCGAGGG - Intronic
925993126 2:9269595-9269617 CCGGGTGACCCCAGAGGTGGTGG + Intronic
926619650 2:15035901-15035923 CAGGCTCAATACATAGGTGATGG + Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927140216 2:20125062-20125084 CACGGTGTACAGAGAGGTGGGGG + Intergenic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932688207 2:73891450-73891472 GAGGGAGGACACAGAGCTGAGGG + Intergenic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
934615670 2:95769204-95769226 AAGGTTGAACACACAGGGGAGGG + Intergenic
934776290 2:96939701-96939723 CTGGCTGACCACAGAGGAGATGG + Intronic
935257237 2:101321680-101321702 TAGCTTGAACCCAGAGGTGAGGG - Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
937159059 2:119742918-119742940 TAGGGTGAACATAAAGGTGGAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938804404 2:134792726-134792748 CATGATGAACACAGAGTTGATGG + Intergenic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939626690 2:144485701-144485723 CAGCTTGAACCCAGAGGCGAAGG - Intronic
942414614 2:175745742-175745764 GATGGTGCACACTGAGGTGAGGG - Intergenic
943464483 2:188211707-188211729 CAGATTGAAAACTGAGGTGAGGG + Intergenic
944268613 2:197755787-197755809 CAGGCTTAACACCTAGGTGATGG + Intronic
946168884 2:217882012-217882034 CAGGGGGCACACAAAGGTGCTGG - Intronic
1169196421 20:3685158-3685180 AAGGCTGAACACAGAGGGGCTGG + Intergenic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1169850063 20:10038502-10038524 CAGGGTGAGCACCAAGGTCAAGG - Exonic
1170124797 20:12950654-12950676 TAGGGTGAACACAGCAGAGATGG - Intergenic
1170620348 20:17990499-17990521 CAGGGTTCACCCAGAGGGGAAGG + Exonic
1170848341 20:19981265-19981287 GAAGGTGACCTCAGAGGTGAAGG + Intronic
1171353278 20:24522049-24522071 CAGGATGAACACAGCTGTCAGGG - Intronic
1171384542 20:24761378-24761400 CAAGATCAACACAGAGGTGTGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172301574 20:33854077-33854099 CAGGGCCAATACACAGGTGATGG - Exonic
1173367700 20:42402130-42402152 CAGAGAGAGCACAGAGGTGTGGG + Intronic
1174205582 20:48835917-48835939 CAGGGTGATACCAGAGGAGATGG + Intergenic
1174537141 20:51260030-51260052 CAGGGTGAAGTCATGGGTGAGGG - Intergenic
1175966180 20:62661281-62661303 CAGGGTCACGACAGAGGTTAGGG - Intronic
1176265223 20:64205682-64205704 CAGTGAGGACACTGAGGTGAAGG + Exonic
1177262717 21:18750811-18750833 AAGGGTGAGCACAGCGGTAAGGG - Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178375981 21:32067796-32067818 CATGGTGGCAACAGAGGTGATGG - Intergenic
1178403030 21:32303526-32303548 CAGTGTGGACCCAGAGGGGAAGG + Intronic
1178709418 21:34901567-34901589 CGGGTTGAAGACAGAGGTTAAGG + Intronic
1179305858 21:40153528-40153550 CATGGTGATCACAGGGGTGGGGG + Intronic
1180934346 22:19614723-19614745 CATGTTGAAAATAGAGGTGATGG + Intergenic
1181294818 22:21828474-21828496 CCGGGAAAACACAAAGGTGAGGG + Intronic
1182048157 22:27292597-27292619 CAGGCTGAACACGCAGGAGAAGG + Intergenic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1183084981 22:35481149-35481171 GAGGCTTAAAACAGAGGTGAGGG + Intergenic
1183368329 22:37418768-37418790 CAGGCTGAGCACATAGGGGAAGG - Intronic
1183549048 22:38470542-38470564 CAGAGAGAAGTCAGAGGTGATGG + Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184498514 22:44857934-44857956 CAGAGGGACCACAGAGCTGAGGG + Intronic
1184668410 22:46000579-46000601 TTGGGTGAGGACAGAGGTGAGGG - Intergenic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
951069462 3:18309755-18309777 AAGGGAGAACACAGAGGGGTGGG - Intronic
951726599 3:25767482-25767504 CAGGTTGAAGAAAGAGGTGCAGG + Intronic
952523520 3:34185868-34185890 CTGAGTGCACACACAGGTGAAGG - Intergenic
953064119 3:39453748-39453770 CAGGGAGAAAACAGAGAAGATGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953437122 3:42886820-42886842 CAGGGGAAAGACAGAGGTTATGG - Intronic
954605097 3:51903309-51903331 CTGGATGAACACAGATGTGAGGG - Exonic
955004598 3:54956913-54956935 TAGGTTGAAAACAGGGGTGAAGG + Intronic
957440121 3:80234694-80234716 GATGGTGACCACAGGGGTGAGGG - Intergenic
957520506 3:81312670-81312692 AAGGTAGAAGACAGAGGTGAAGG + Intergenic
958132314 3:89443721-89443743 CTGGGGGAATACAGTGGTGAAGG + Intronic
959110357 3:102115625-102115647 CAGGGAGAGCACTGAGGTAATGG - Intronic
960447906 3:117770336-117770358 CAAGATGAAGACTGAGGTGAAGG + Intergenic
961343365 3:126245302-126245324 CAGGGTGGACCCAGAGGAGCAGG + Intergenic
962853404 3:139324699-139324721 CAGGGGACACACAGAGGAGAAGG - Intronic
965647576 3:170899974-170899996 CAGGGAGACAGCAGAGGTGAGGG + Intronic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969173001 4:5379018-5379040 CAGGGTCAACACTAAGGTCAGGG + Intronic
969464123 4:7344621-7344643 GAGAGTGGACACTGAGGTGAGGG + Intronic
970274870 4:14387703-14387725 CAGGGTCAAGTCAGAGGAGAAGG - Intergenic
970284732 4:14498211-14498233 CAGAGTGAAGACACAGGTTAGGG + Intergenic
971887680 4:32474071-32474093 CAGGCTGAAAACAAAGGTAATGG + Intergenic
972438694 4:39061941-39061963 AAGGGAGAAGATAGAGGTGAAGG + Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
975327898 4:73080720-73080742 CAGAGTGAACACAGAGGTTAAGG - Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975829796 4:78357301-78357323 CATGGTGGACACTGAGGTGGAGG - Intronic
977529039 4:98177848-98177870 CAGAGTGAACAAAGTGGTTAAGG - Intergenic
977532293 4:98214523-98214545 CTGGGTGAACACAAATGTGGGGG + Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
979410751 4:120375764-120375786 CTGGTGGAACACAGAGGTGATGG - Intergenic
980714931 4:136616119-136616141 AAAGGTGAACACAGTGGGGAGGG - Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
986224730 5:5801960-5801982 CACCGTGACCACAGAGGCGACGG - Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987087868 5:14487048-14487070 CAGGCTGAACACAGCCCTGAGGG - Intronic
987112432 5:14700580-14700602 GAGGGTGAGCACAGAGGGTATGG - Intergenic
989661580 5:43804564-43804586 AAGGAGGAACACAGATGTGAGGG - Intergenic
990007499 5:50960880-50960902 CAGGGAGAAGGCAGAGGTAATGG + Intergenic
990924028 5:60998652-60998674 CAGGATGATCACAGAGATTAGGG - Intronic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
997716676 5:136047865-136047887 CAGTGTGGACACAGAAGTCAAGG + Intronic
998758270 5:145404472-145404494 CAGAGTGAACACCAAGGTGAAGG + Intergenic
1000372486 5:160550363-160550385 GAGGCAGAACTCAGAGGTGAGGG + Intergenic
1002172625 5:177383971-177383993 CAGGGGGAGCTCAGAGGAGAGGG - Intronic
1002843104 6:922845-922867 CAGGGTGAACCCAGAGAAGCAGG - Intergenic
1003190147 6:3867341-3867363 GGTGGTGAACACAGAGGTGCTGG - Intergenic
1005704102 6:28434650-28434672 CAGTGTGAATTCTGAGGTGATGG + Exonic
1005846850 6:29788349-29788371 CAGGGTTAATACATAGGTGATGG + Intergenic
1005851137 6:29823389-29823411 CAGGGTTAACACCTAGGTGATGG + Intergenic
1006284569 6:33082677-33082699 CAGGGAAAACACAGAGGCAAGGG + Intronic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1010318337 6:74476297-74476319 CACTGGGAATACAGAGGTGATGG + Intergenic
1010774969 6:79875028-79875050 CAGGTTGAACACAGAAGATACGG - Intergenic
1013448611 6:110256631-110256653 CAAGGTGATCACAGAGGTGGAGG - Intronic
1014586240 6:123201832-123201854 CAGAGTGGACACAGAGGCCAAGG - Intergenic
1014792257 6:125686749-125686771 CAGGGGGAAGAGGGAGGTGAGGG - Intergenic
1016434609 6:144023245-144023267 CTGGGTGAACACAGAGGATTTGG + Intronic
1018629122 6:165806754-165806776 TAGTGTGAACACAGATGTCAAGG + Intronic
1018674805 6:166209904-166209926 CTGGGTGAAAATAGAGGTAAAGG + Intergenic
1019152454 6:170017985-170018007 CATGGTGAGCCAAGAGGTGAAGG + Intergenic
1019793432 7:3032440-3032462 CAGTTTGACCTCAGAGGTGAGGG + Intronic
1020088659 7:5324998-5325020 GAGGGTGAATACAGAGGAGCAGG + Intronic
1020241479 7:6398432-6398454 GATGGTGAAGACAGAGGTCAGGG - Intronic
1020730351 7:11871396-11871418 CAGGAAGACCACAGAGGTCAAGG + Intergenic
1020916944 7:14206356-14206378 CCAGGTGAACAAGGAGGTGATGG + Intronic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1022204498 7:28150255-28150277 CAGGGTGAGCAAAGATGTGCTGG + Intronic
1023310611 7:38882617-38882639 CAGGGTGAAAATAGTGGTGGTGG - Intronic
1023711009 7:42992508-42992530 TAGGGGTAACAAAGAGGTGATGG - Intergenic
1023769206 7:43539682-43539704 AAAGGTCAGCACAGAGGTGATGG - Intronic
1023864864 7:44233813-44233835 CTGAGGGAACACAGAGGTGACGG + Intronic
1026445343 7:70479793-70479815 TAGGGTTAGCACAGTGGTGAGGG - Intronic
1026766073 7:73160680-73160702 CAGGGTTACCACAGAGGACAAGG - Intergenic
1027042548 7:74970376-74970398 CAGGGTTACCACAGAGGACAAGG - Intronic
1027081095 7:75231981-75232003 CAGGGTTACCACAGAGGACAAGG + Intergenic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1029491479 7:100872804-100872826 GAGGGGGAACACAGAGGTCTGGG + Intronic
1029579546 7:101426435-101426457 CATGGTGGACACACAGGTGTGGG - Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1032635115 7:133698275-133698297 CAGTCTCAACACAGAAGTGAAGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1035214587 7:157355687-157355709 CAGGAGGAGCGCAGAGGTGAGGG + Intronic
1035249010 7:157584849-157584871 CAGGGTGAGAGCAGAGCTGAAGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035855520 8:2972485-2972507 AAAGGTGAACTGAGAGGTGATGG - Intronic
1036283461 8:7421787-7421809 TAGGATGAACACAGCTGTGAAGG - Intergenic
1036338010 8:7889734-7889756 TAGGATGAACACAGCTGTGAAGG + Intergenic
1037285850 8:17299491-17299513 CATGATGATCACAGATGTGAGGG + Exonic
1037629412 8:20639852-20639874 CAGAATGAAAGCAGAGGTGATGG - Intergenic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038993835 8:32899941-32899963 CAGTGAGAAAACAGAGGTTACGG + Intergenic
1039247002 8:35620114-35620136 CATGTTGAATACAGAGGTGAAGG - Intronic
1039833795 8:41238881-41238903 CAGGAGGAAAACAGAGGTGGGGG + Intergenic
1039840148 8:41287162-41287184 CAGGAAGAAAACAGATGTGAGGG - Intronic
1042104348 8:65308816-65308838 AAAGGTGGACACAGAGTTGAAGG + Intergenic
1042363726 8:67912083-67912105 CAGTGTGAACCCAGAGGAGTGGG - Intergenic
1042375325 8:68044541-68044563 CCGGATCAACACGGAGGTGATGG + Exonic
1042712409 8:71733191-71733213 AAGGGTGAACACTGAGGTGAGGG + Intergenic
1042817619 8:72894846-72894868 CAGTGAGAACACAGACATGATGG + Intronic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1044539378 8:93392511-93392533 GAGGGAGAAAACAGGGGTGATGG - Intergenic
1044598390 8:93980198-93980220 CAGTTTCAACACTGAGGTGAAGG + Intergenic
1044773430 8:95661932-95661954 TAAGGAGAACAGAGAGGTGAGGG - Intergenic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1047138572 8:122108760-122108782 CTCTGTGAACACAGATGTGAGGG + Intergenic
1048062553 8:130935489-130935511 CAGGAGGGACACAGAGGTCATGG - Intronic
1048924576 8:139260012-139260034 CAGAGTGAAGGCAGAGGTGAGGG + Intergenic
1048976399 8:139675255-139675277 AAGGGTGAGCAAAGAGGTGCTGG - Intronic
1049067535 8:140329161-140329183 CCTGGGGAACACAGAGGTGAGGG + Intronic
1050611075 9:7354387-7354409 TAGGGAGAACACAGGAGTGAAGG + Intergenic
1051715425 9:19977941-19977963 CAGGGTGGACAGATAAGTGATGG + Intergenic
1051923070 9:22290656-22290678 CAGAGAGAACAAAAAGGTGAAGG - Intergenic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1053564458 9:39233790-39233812 CATGGTAATAACAGAGGTGAGGG + Intronic
1053830240 9:42071692-42071714 CATGGTAATAACAGAGGTGAGGG + Intronic
1054132693 9:61385246-61385268 CATGGTAATAACAGAGGTGAGGG - Intergenic
1054600319 9:67115763-67115785 CATGGTAATAACAGAGGTGAGGG - Intergenic
1054760878 9:69003028-69003050 TCGGGTGAACCCAGAGATGAAGG + Intronic
1056076300 9:83044405-83044427 TAGGGTGAAGACAGAGGGGTAGG + Intronic
1057353040 9:94316310-94316332 CAGGCGGGACACAGAGGTGAAGG + Intergenic
1057654706 9:96941281-96941303 CAGGCGGGACACAGAGGTGAAGG - Intronic
1058024931 9:100132025-100132047 GAGGGGGAATACAGAGCTGAAGG - Intronic
1059084744 9:111288004-111288026 GAAGGAGAACACAGAGGAGAGGG + Intergenic
1059801297 9:117752165-117752187 CCGGGTGAACAAAGTGGTAAAGG - Intergenic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062649995 9:137570679-137570701 GAGGGTGAAATCAGAGGTAATGG - Intronic
1185583537 X:1228386-1228408 ATGGTTGAACAGAGAGGTGAAGG - Intergenic
1185772508 X:2775535-2775557 CTGGAAGTACACAGAGGTGATGG + Intronic
1187849760 X:23580231-23580253 CAGTGTCAGCAAAGAGGTGAGGG - Intergenic
1188371589 X:29376306-29376328 CTGGGTGAACACTGAAATGAAGG - Intronic
1189078303 X:37941463-37941485 CCGGGTGAACACGGAAGGGATGG - Intronic
1189519542 X:41751622-41751644 CAGGGTGATCTAAGAGGTTAAGG + Intronic
1190332601 X:49245102-49245124 CTGGGTGAACACAGAGGAAGAGG - Intronic
1191675532 X:63788450-63788472 GAGAGTGAACACAGAGATTATGG - Intergenic
1192597003 X:72421319-72421341 CAGGCTTAACACCTAGGTGATGG - Intronic
1196520756 X:116668156-116668178 CAGGGTGGACTCAGAGGAGCAGG - Intergenic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200009598 X:153111227-153111249 CAGGCACAACACAGAGATGAAGG - Intergenic
1200030002 X:153288695-153288717 CAGGCACAACACAGAGATGAAGG + Intergenic
1201298234 Y:12483917-12483939 CTGGAAGCACACAGAGGTGATGG - Intergenic