ID: 986705747

View in Genome Browser
Species Human (GRCh38)
Location 5:10453316-10453338
Sequence TACCCAGCGCACCCCGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986705747_986705751 3 Left 986705747 5:10453316-10453338 CCTGTCTCGGGGTGCGCTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 986705751 5:10453342-10453364 AGGAGGTGCTCGGACCCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 128
986705747_986705750 -7 Left 986705747 5:10453316-10453338 CCTGTCTCGGGGTGCGCTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358
986705747_986705752 9 Left 986705747 5:10453316-10453338 CCTGTCTCGGGGTGCGCTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 986705752 5:10453348-10453370 TGCTCGGACCCTCCAGGCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 147
986705747_986705753 14 Left 986705747 5:10453316-10453338 CCTGTCTCGGGGTGCGCTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 986705753 5:10453353-10453375 GGACCCTCCAGGCCTTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986705747 Original CRISPR TACCCAGCGCACCCCGAGAC AGG (reversed) Intronic
902793468 1:18784771-18784793 CACCCTGGGCACCCCGAGGCTGG - Intergenic
904783075 1:32964910-32964932 TGCCCAGCGCACTCCTAGACCGG - Intergenic
905522001 1:38607705-38607727 GAGCCAGCCCACCCCGAGAGAGG - Intergenic
918547986 1:185707544-185707566 TACCCTGCGCAAGCCGAAACAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1076554379 10:131312019-131312041 GACCCAGCGCACCGCGAGGGAGG + Intergenic
1083657463 11:64236363-64236385 TACCCAGCACCCCCCAAGCCTGG - Intronic
1105404690 13:20123674-20123696 TATCCAGGGCATCCCCAGACAGG + Intergenic
1118835597 14:69475705-69475727 TCCCCAGCGCACCCAGAGATGGG + Intergenic
1122515943 14:102308502-102308524 TGCCCAGCTCACCCAGAGCCAGG + Intergenic
1122691050 14:103532365-103532387 ACCCCAGCTCACCCCTAGACAGG + Intronic
1124120213 15:26882657-26882679 TGCCCAGTGCGCCCTGAGACAGG - Intronic
1129874062 15:78960822-78960844 TACCCAGCCCAGCCTGGGACCGG - Exonic
1138957747 16:61991830-61991852 TCCCCAACCCACCCAGAGACTGG + Intronic
1139637214 16:68264850-68264872 TCGCCAGCACACCCCAAGACTGG - Intronic
1141919339 16:87125699-87125721 TTCCCCACGCACCCCGAGGCCGG + Intronic
1144707888 17:17381356-17381378 TGGACACCGCACCCCGAGACAGG + Intergenic
1148187633 17:45656073-45656095 TACCCAGCCCACCCCGAAACTGG - Intergenic
1152331214 17:79674395-79674417 AGCCCAGGGCACCCCAAGACAGG + Intergenic
1161305330 19:3564210-3564232 TCCCCACCCCACCCCGAGGCTGG - Intronic
1162019917 19:7863708-7863730 TGCCCAGCGCGCCCGGAGTCAGG + Intronic
1162069719 19:8146391-8146413 TGCCCAGCCCAGCCCGAGAGTGG - Intronic
1162145379 19:8609802-8609824 CACCCCGCGCAACCAGAGACCGG + Intronic
1162398361 19:10430808-10430830 TCCCCAGCGCCCGCCGAGGCGGG + Intronic
1162504608 19:11075848-11075870 TGTCCAGCGCACCCTGAGACAGG + Intergenic
1163604035 19:18264548-18264570 CACCCAGCTCACCCTGACACAGG + Exonic
1164615884 19:29666480-29666502 AACCCAGCCCACCCCGAGGAAGG + Intronic
1165707105 19:37984121-37984143 CACACAGCGCTCCCTGAGACTGG - Intronic
926740299 2:16105042-16105064 TACCCAGCCCAGCCTGAGCCAGG + Intergenic
942771545 2:179526732-179526754 TACCCAGAGCACCCTGACAAGGG + Intronic
1169209987 20:3760471-3760493 TCCCCAGCACCCCCAGAGACTGG + Intronic
1172968668 20:38857710-38857732 TAACCAGAGCACACCAAGACTGG - Intronic
1173288400 20:41693149-41693171 TGCCCAGGGGACCCCGAGGCGGG - Intergenic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1185078484 22:48696102-48696124 CGCCCATCGAACCCCGAGACTGG - Intronic
1185382469 22:50516337-50516359 TGCCCAGCACCTCCCGAGACGGG - Intronic
950670306 3:14521840-14521862 TTCCCAGCGCCCTCCCAGACAGG - Intronic
952784962 3:37144060-37144082 TACCCTGGGCACCCCAAGACAGG + Intronic
956051040 3:65248794-65248816 TACCCAAGGCACCCAGAGATGGG - Intergenic
986083562 5:4419508-4419530 TGCCCAGCTTACCCCGTGACAGG + Intergenic
986705747 5:10453316-10453338 TACCCAGCGCACCCCGAGACAGG - Intronic
993116128 5:83722140-83722162 TCCCCAGCGCTCCGCGACACCGG - Intergenic
1003542597 6:7031674-7031696 TACCCGGAGAACCCAGAGACAGG - Intergenic
1010106784 6:72179804-72179826 CTCCCAGCGCACCACCAGACAGG + Exonic
1029331528 7:99860366-99860388 TGCCCAGCGCACCCAGGGCCAGG - Intronic
1036430910 8:8689579-8689601 TACCCAGCCCAGCCAGAGAATGG + Intergenic
1043341050 8:79240110-79240132 GACCCAGTGCACCCTGAAACTGG - Intergenic
1045506066 8:102779589-102779611 CAGCCAGCCCACCCCGAGCCAGG - Intergenic
1057694725 9:97315001-97315023 AACCCAGGGCACCCCGAGCCTGG + Intronic
1058928218 9:109689788-109689810 TACCCAGCTCCTCCAGAGACAGG - Intronic
1062680354 9:137775811-137775833 TGCCCAGGGCCCCCCGAGAATGG + Intronic
1189007301 X:37009437-37009459 CACCCAGAGCCTCCCGAGACTGG + Exonic
1189040962 X:37542190-37542212 TGCCCAGAGCCTCCCGAGACTGG - Intronic
1189041267 X:37543612-37543634 TGCCCGGAGCCCCCCGAGACTGG - Intronic