ID: 986705750

View in Genome Browser
Species Human (GRCh38)
Location 5:10453332-10453354
Sequence CTGGGTAGACAGGAGGTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 358}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986705741_986705750 22 Left 986705741 5:10453287-10453309 CCACAGAGTGCTGAGCACGAGTT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358
986705740_986705750 23 Left 986705740 5:10453286-10453308 CCCACAGAGTGCTGAGCACGAGT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358
986705747_986705750 -7 Left 986705747 5:10453316-10453338 CCTGTCTCGGGGTGCGCTGGGTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358
986705738_986705750 30 Left 986705738 5:10453279-10453301 CCCGCGGCCCACAGAGTGCTGAG 0: 1
1: 0
2: 0
3: 16
4: 252
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358
986705739_986705750 29 Left 986705739 5:10453280-10453302 CCGCGGCCCACAGAGTGCTGAGC 0: 1
1: 0
2: 0
3: 35
4: 396
Right 986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG 0: 1
1: 0
2: 6
3: 34
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986705750 Original CRISPR CTGGGTAGACAGGAGGTGCT CGG Intronic
900733331 1:4277702-4277724 CTGGGTACAGAGAAAGTGCTTGG + Intergenic
901031074 1:6307183-6307205 CTCGGCACACAGGAGGTGCCTGG + Intronic
901055152 1:6445818-6445840 CTGGGTAGCCAGGTGGGGGTGGG - Exonic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901336067 1:8450454-8450476 CTGGGAATACAGGAAGGGCTGGG - Intronic
901443861 1:9295074-9295096 CTGGGGAGACACGAAGTGCCTGG - Intronic
901739263 1:11331565-11331587 CTGTGATGACAGGAGCTGCTGGG + Intergenic
902383691 1:16064644-16064666 CTGAGAAGACAGGAGATGCTTGG - Intronic
902758047 1:18562264-18562286 CTGGATGGACTGGAGGGGCTGGG - Intergenic
903259561 1:22124047-22124069 CTGGGCAGAGATGAGGAGCTGGG - Intronic
903269353 1:22178018-22178040 CTGGGCAGGCAGGGGGTGCGGGG - Intergenic
904392614 1:30195956-30195978 CTCGGGAGACACGGGGTGCTGGG - Intergenic
904421571 1:30397826-30397848 CCTGGTACACAGTAGGTGCTTGG - Intergenic
904482930 1:30805437-30805459 CTGGCCAGGAAGGAGGTGCTGGG + Intergenic
904610473 1:31723265-31723287 GTGGGTAGGGAGGAGGTGTTGGG - Intergenic
904756207 1:32770156-32770178 CTGGATTGACAGGAGGGGCAGGG + Exonic
904923649 1:34028842-34028864 CTGAGATGACAGAAGGTGCTTGG - Intronic
906075599 1:43049649-43049671 CTGGGGAGAAGGGAGGTGCCAGG + Intergenic
906668387 1:47637798-47637820 ATGGGTTAGCAGGAGGTGCTTGG + Intergenic
906688849 1:47779598-47779620 CTCTGGACACAGGAGGTGCTGGG + Intronic
907270393 1:53287774-53287796 ATGGGAAGGCAGCAGGTGCTGGG + Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
915593081 1:156881606-156881628 CCAGGTAGACAGGAGGTGCCTGG - Exonic
916487525 1:165272712-165272734 CTGGGTACTCTGGAGCTGCTGGG - Intronic
916786898 1:168092961-168092983 CTGGGGAGAGGGGTGGTGCTCGG + Intronic
917148560 1:171919866-171919888 CTGGGTAGACACCAGGAGTTCGG - Intronic
917478512 1:175389476-175389498 CTGGGCAGACAGGCCTTGCTGGG + Intronic
917567762 1:176230210-176230232 CTGGGGAGTCAGTAGGTGTTGGG - Intergenic
919736502 1:200955718-200955740 TTGGGTTGACAGAAGGTCCTAGG - Intergenic
919785026 1:201253386-201253408 TTAGGTGGACAGGAGGTGCAGGG + Intergenic
919850437 1:201668595-201668617 AAGGGTAGAGAGGTGGTGCTGGG + Intronic
919861265 1:201740567-201740589 CTGGGGTGAAAGGAGGTGGTGGG + Intronic
919958777 1:202444969-202444991 CTGGGTGGGAAGGTGGTGCTGGG + Intronic
920242416 1:204562672-204562694 CAGGGCAGACCGGCGGTGCTTGG - Intergenic
920288643 1:204900662-204900684 CAGGGGAGACAGGGAGTGCTGGG + Intronic
923348447 1:233080306-233080328 TTGGGGAGACAGCAGGTACTGGG - Intronic
923765047 1:236885444-236885466 CTGGGTACCCAGTAGGTGTTAGG + Intronic
1063333365 10:5184912-5184934 TTGGGTAGACAGTGGATGCTTGG - Intergenic
1064145836 10:12825770-12825792 CCTGGCAAACAGGAGGTGCTCGG - Intronic
1065088013 10:22199793-22199815 CTGGATAGACAGGATGTACTGGG + Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065919398 10:30378881-30378903 CTGGGCCCACTGGAGGTGCTAGG - Intergenic
1066061853 10:31731041-31731063 CTTGGTAACCAGTAGGTGCTAGG + Intergenic
1070299084 10:75189738-75189760 CTGTGTAAACAGGAGCTGCTTGG - Intergenic
1071433327 10:85623586-85623608 CAGGGAAGAGAGGAGTTGCTTGG - Intronic
1071451288 10:85793292-85793314 CTGGATGGACAGCAGCTGCTAGG - Intronic
1073070897 10:100792641-100792663 TTGGGAAGCCAGGAGGTGCTAGG + Intronic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073620962 10:105047879-105047901 GTGTGTAGACAAGAGGTCCTAGG + Intronic
1074696531 10:116054671-116054693 ATGGGTAGACAATAGATGCTAGG - Intergenic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075736302 10:124666632-124666654 CTGGGGAGATGGGAGGTGGTGGG - Intronic
1076924506 10:133475677-133475699 CTGGGCAGCCAGGAGGTCTTTGG + Intergenic
1078403039 11:11044787-11044809 CTGGGCTGAGAGGAGGGGCTGGG + Intergenic
1078944935 11:16054928-16054950 CTGGGCAGCCAGGAGGTACTTGG - Intronic
1081237053 11:40658935-40658957 CTGGATAGCCAGCAGGAGCTGGG + Intronic
1081302877 11:41474729-41474751 ATGGGTAAACAGGATGTACTAGG + Intergenic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1081715397 11:45246405-45246427 CTGGTTAGAGTGGAGGTTCTTGG + Exonic
1083463208 11:62828928-62828950 CTGGGAATACAGGCGGTGCCAGG - Intronic
1083576704 11:63797120-63797142 CTGGGTACACAGCAGGTGATGGG - Intergenic
1083936433 11:65872326-65872348 CCGGGTAGGCAGGAGGCGCAGGG + Exonic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1084951843 11:72670781-72670803 CTGGGTAGCCTGGAGTTGCTGGG + Intronic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1085454481 11:76657956-76657978 CTGGGAAGAATGGACGTGCTGGG - Exonic
1086759698 11:90612527-90612549 CTAGGTAGCCTGTAGGTGCTGGG + Intergenic
1088585385 11:111356336-111356358 CTGGGTAGGCAGGTGGACCTGGG + Intronic
1088775602 11:113079385-113079407 ACGGGTATAGAGGAGGTGCTGGG - Intronic
1089130506 11:116208316-116208338 ATGGGCAGACAGGTGGTGGTAGG + Intergenic
1089707449 11:120289962-120289984 TTTGGTATACAGTAGGTGCTTGG + Intronic
1090012897 11:123061444-123061466 GTGCTTAGACAGGAGGTGATGGG - Intronic
1091452087 12:578830-578852 CTGGGAAGACAGGAGCTGCTGGG - Intronic
1091452224 12:579979-580001 CTGGGAAGACAGGAGCTGCTGGG + Intronic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1093491755 12:19712814-19712836 CTAGGTAGACATGTGGAGCTAGG - Intronic
1093725710 12:22506000-22506022 CTGGGTAGACTGGAGGGGACAGG + Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096088698 12:48883754-48883776 CTGGGAACAAAGGAGGTGTTTGG - Intergenic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1096623071 12:52876589-52876611 CTGGGTTGGCAGCTGGTGCTGGG - Intergenic
1097029463 12:56080702-56080724 TTCTGTAAACAGGAGGTGCTTGG + Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097937803 12:65273090-65273112 CAGGTGAGACAGGAGGTGATTGG - Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1101262504 12:103047330-103047352 CTGGGCAGATGGGAGGTGATTGG - Intergenic
1101438846 12:104687630-104687652 CTGGGCAGTGAGGAGGTTCTGGG + Intronic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1105722936 13:23134763-23134785 GTGGGTGGACAGGGGGAGCTGGG - Intergenic
1105805562 13:23950009-23950031 CTGGGCAGCCAGGGGGTGCCAGG + Intergenic
1106035577 13:26041688-26041710 CTGGGGAGAGAGGTGATGCTGGG - Intergenic
1106476262 13:30100813-30100835 CCTGATAGACAGAAGGTGCTTGG - Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108642803 13:52398010-52398032 CTGGTTGGTCAGGAGGTACTTGG + Exonic
1113127129 13:106991774-106991796 CTGGGTAGCCAGGCAGTGATGGG - Intergenic
1113932121 13:113974058-113974080 GGGAGTAGTCAGGAGGTGCTGGG + Intergenic
1114489672 14:23091480-23091502 CTGGCTACTCAGGAGGTGGTGGG + Intronic
1114652569 14:24295476-24295498 ATGGGTGGGCAGGAGGTGCTGGG + Intronic
1114665723 14:24376271-24376293 CTGGGAAGACAGGAAGTGGGAGG - Intronic
1114853561 14:26410387-26410409 CTGGATAGGCAGGAGTTGCTGGG + Intergenic
1116635625 14:47390974-47390996 CTGGCTAGACAGGAGATGGTAGG - Intronic
1118738204 14:68717634-68717656 CTGCATTGACAGGAGATGCTTGG + Intronic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1119609105 14:76046636-76046658 CTTGGCACACAGGAAGTGCTCGG - Intronic
1119888145 14:78161826-78161848 CTGGATATACAGTAGGTGTTAGG - Intergenic
1121729144 14:96174220-96174242 CCGGGTAGACAGAAGGGCCTGGG + Intergenic
1122320224 14:100851193-100851215 CTGGATAGGCAGGAAGGGCTTGG + Intergenic
1122432122 14:101658688-101658710 TTGTATAGACAGGAGATGCTTGG + Intergenic
1125533245 15:40427807-40427829 CTGGAAAGAAAGGAGGGGCTGGG - Intronic
1126099822 15:45112428-45112450 CTGCGTAGAGAGGAAGTGGTTGG + Intronic
1126466379 15:48964806-48964828 CTTGGCAGACAGGATGTGATGGG - Intergenic
1127293180 15:57588429-57588451 CTCAGTACACAGTAGGTGCTTGG + Intergenic
1127500439 15:59549537-59549559 CTGGTGAGACAGGAGGTGAAAGG + Intergenic
1129275489 15:74442696-74442718 CTGGGTGGAGGGGAGCTGCTAGG - Intergenic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129616892 15:77105854-77105876 CTGGGTTGTCCGGAGGTGATGGG - Exonic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1129893612 15:79088582-79088604 CTGGGTAGGCAGGAAGTGAGGGG - Intronic
1130057999 15:80545525-80545547 CAGGGTAGAGAGGAGATGATTGG + Intronic
1132463526 16:67181-67203 TTGGGAAGGCAGGTGGTGCTCGG + Intronic
1132880681 16:2160513-2160535 GTGGGTGGGCGGGAGGTGCTCGG + Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136071722 16:27791510-27791532 GTGGGTAGACAGGATGTGGGTGG - Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1141447250 16:84069047-84069069 ACGGGTAGACAGGAAGTGGTGGG - Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1142183757 16:88684885-88684907 CAGGATAGACCTGAGGTGCTGGG - Intronic
1143029746 17:3961346-3961368 GTGGGCTCACAGGAGGTGCTGGG + Intronic
1143372090 17:6446784-6446806 CTTGGTGTACAGGGGGTGCTGGG + Intronic
1143895716 17:10134785-10134807 CTGGGCAGACAGTAGAAGCTCGG + Intronic
1145101274 17:20079862-20079884 CTGGGTGGGCAGGAGGCGCAAGG + Intronic
1145302980 17:21653734-21653756 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1145347060 17:22048107-22048129 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1146059328 17:29596290-29596312 ATGGGCAGATAGGAGGTGCCTGG + Intronic
1146677329 17:34782442-34782464 CTGGGTTGTCAGCAGCTGCTAGG - Intergenic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1147605519 17:41771932-41771954 GTGGGAAGACAGGCGGGGCTTGG - Intronic
1148676343 17:49447756-49447778 TTTGGCAGCCAGGAGGTGCTGGG + Intronic
1148737099 17:49871016-49871038 CTGGGTACAGAGGAGGAGTTGGG + Intergenic
1151299876 17:73216311-73216333 CTGGGCAGACAGCAGGTGTTTGG + Intronic
1151492186 17:74439355-74439377 CAGGGCAGAGAGGAGGTACTGGG + Intronic
1151499856 17:74481703-74481725 CTGGGTGGGCAGGAGGTCCCAGG - Intronic
1152641154 17:81449804-81449826 CTAAGAAGCCAGGAGGTGCTCGG - Intronic
1155422481 18:25670006-25670028 CTGGTTGAACAGGAGATGCTGGG - Intergenic
1155543631 18:26891223-26891245 CTGTGTAGACAGGACCTTCTGGG + Intergenic
1156467397 18:37356509-37356531 CTGGGAAGGCCAGAGGTGCTGGG + Intronic
1156959239 18:43003028-43003050 CAGGGCAGCCAGGAGGAGCTGGG + Intronic
1157493298 18:48138577-48138599 CTGGGCAGCCAGGATGTGGTGGG + Intronic
1157551105 18:48582400-48582422 CTGGGGATAAAGGAGGTGCCTGG + Intronic
1157712592 18:49860076-49860098 CTGGATGGAGAGGAGCTGCTAGG + Intronic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1159123496 18:64196761-64196783 CTGGGTGGAGAGGAGGCGGTAGG + Intergenic
1159297405 18:66512794-66512816 CTGGGTAGAGGGCAGGGGCTTGG + Intronic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1161114050 19:2487165-2487187 CTGGGTAGGCAGGAAGTACCAGG - Intergenic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161612716 19:5251915-5251937 CTGGGAATACAGGAGGTGAGGGG + Intronic
1162152356 19:8655458-8655480 CTGGGCAGACACCAGGTGCGGGG + Intergenic
1162369120 19:10268509-10268531 CTGGGCCAACTGGAGGTGCTGGG - Intergenic
1163177226 19:15572939-15572961 CTGGGCAGACAGGGTGTCCTAGG + Intergenic
1164393446 19:27844735-27844757 CTGGGTAGATAGCTGCTGCTAGG + Intergenic
1164829750 19:31311353-31311375 CTGGGGAGGCAGGAGAAGCTGGG + Intronic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165112089 19:33508346-33508368 CTGGGTAGAGAGGGGATGCTGGG + Intronic
1165996798 19:39849353-39849375 CTGGAGAGACAGGAGGTGACGGG - Intergenic
1166547432 19:43641592-43641614 CTGGGGACACAGGAGTTGATAGG - Intergenic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167671483 19:50856188-50856210 CAGGGTTGACAGGAGGAACTGGG - Intronic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168714051 19:58516959-58516981 CTGGGAAGGAAGGAGGTGCCTGG + Exonic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
929768969 2:44875420-44875442 CTGGGAAGGCATGAGGTGGTTGG + Intergenic
931829653 2:66037655-66037677 CTGGGGAGACAGGAAGTGCCTGG + Intergenic
932064781 2:68543170-68543192 CGGGGAGGACAGGAGGAGCTGGG + Intronic
932686701 2:73876579-73876601 CTTGGGAGACAGGAGAAGCTGGG - Intergenic
933584124 2:84161463-84161485 ATGGGCAGCCAGGAGGAGCTGGG + Intergenic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
936147171 2:109987680-109987702 CTGGGAAGGAAGGAGGTGCTTGG + Intergenic
936197521 2:110383803-110383825 CTGGGAAGGAAGGAGGTGCTTGG - Intergenic
938201152 2:129374130-129374152 CAGGGTGGGCAGCAGGTGCTGGG + Intergenic
941091599 2:161182775-161182797 CTGAATAGACAGGAACTGCTGGG - Intronic
942655621 2:178211486-178211508 CTGAGGAGACCGGAGGTCCTGGG - Intronic
946273779 2:218615460-218615482 TTGGGTAGGAAGGGGGTGCTGGG + Intronic
946304914 2:218850994-218851016 CTGGATATACAGGAGGTTCCAGG + Intergenic
946459415 2:219855930-219855952 CTGGGTATATAGTAGCTGCTTGG - Intergenic
947345448 2:229185371-229185393 CTAAGTAGACAGGAGGGGATGGG - Intronic
947595970 2:231412132-231412154 CCGGGCAGCCAGGAGCTGCTGGG + Intergenic
948107755 2:235428777-235428799 CTGGTAAGAAAGGAGGTCCTGGG + Intergenic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
948762566 2:240201344-240201366 CTGGGAGGACGGGAGGTCCTGGG - Intergenic
948770182 2:240247849-240247871 TTGGGGAGACAGGACCTGCTGGG + Intergenic
948974680 2:241457060-241457082 CTGAGCAGAGAGGAGGTACTGGG + Intronic
949075277 2:242053377-242053399 CTGTGAAGACAGGAGGTGTTTGG + Intergenic
1168989270 20:2080301-2080323 CTGGGAACACAGGTGCTGCTGGG + Intergenic
1169111778 20:3038788-3038810 TTTGGTGGACAGGAGGAGCTGGG - Intronic
1169350430 20:4863919-4863941 CAGGCTAGACAGAAGCTGCTGGG - Intronic
1169608555 20:7352090-7352112 CTTGGTATACAGTAGATGCTAGG + Intergenic
1170311785 20:15000278-15000300 CTGGGTATAAATGAGGTGTTTGG + Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1171358293 20:24567453-24567475 CTGGGGAGAGTGGAGATGCTGGG - Intronic
1171520501 20:25771426-25771448 CTAGGTAGACAGCAGGTTCAAGG + Intronic
1171556418 20:26085067-26085089 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1172599101 20:36171441-36171463 CTGGGTGGGGAGGAGGTGATGGG + Intronic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1173187567 20:40852645-40852667 GTGGGTAGACAGGAGCTGTATGG + Intergenic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1174113519 20:48212220-48212242 CCTGGTACACAGCAGGTGCTTGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175853685 20:62107423-62107445 CTGGGAAGGCAGGGGGTGCCTGG + Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178717593 21:34980403-34980425 CTGTGAAGATAGGAGGAGCTGGG + Intronic
1178924670 21:36764787-36764809 CTGGGTAGAAAGGGAGTTCTGGG + Intronic
1178970136 21:37167133-37167155 CTGGTTTGACAGGAGAAGCTGGG - Intronic
1179032968 21:37736162-37736184 CTCGGTACACAGGAGGTGCCTGG - Intronic
1179459865 21:41527007-41527029 CAGGGTGGACTGTAGGTGCTGGG + Intronic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1179951563 21:44711503-44711525 CAGGGCAGACATGAGGGGCTTGG + Exonic
1180788154 22:18558392-18558414 GTGGATAGGCAGGTGGTGCTGGG - Intergenic
1181099677 22:20530974-20530996 CTGGACATACAGGAAGTGCTAGG - Intronic
1181233584 22:21436926-21436948 GTGGATAGGCAGGTGGTGCTGGG + Intronic
1181245066 22:21497917-21497939 GTGGATAGGCAGGTGGTGCTGGG - Intergenic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1182351957 22:29704361-29704383 CGGGGTGGTCAGGAGGTGGTGGG - Intergenic
1183309616 22:37102341-37102363 CCTGGCACACAGGAGGTGCTTGG + Intronic
1183492829 22:38125942-38125964 CTAGGTATACAGCAGGTGCTGGG + Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1184240913 22:43210871-43210893 CTGGGAACACGGGAGGGGCTGGG - Intronic
1184690340 22:46114556-46114578 CTGGGTCAACAGGAGGGGCGAGG - Intergenic
1184913627 22:47552154-47552176 CTGGGAATGGAGGAGGTGCTTGG - Intergenic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185113492 22:48917862-48917884 CTGGGCTGTCAGGAGGTTCTAGG - Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185285943 22:49999929-49999951 CTGGGTGGACCGGAGGCGCAAGG - Exonic
949541759 3:5038062-5038084 CTGGATACAGAGGAGGTGGTGGG + Intergenic
950535512 3:13575987-13576009 CCGGGCACCCAGGAGGTGCTCGG + Intronic
951558176 3:23942307-23942329 TTGTGGAGGCAGGAGGTGCTTGG - Intronic
951702451 3:25509943-25509965 CAGGGTGGACAGGAGTTGGTTGG - Intronic
952652147 3:35739388-35739410 ATGGGTAGACAGGACCTGATGGG - Exonic
953205673 3:40826564-40826586 CTGGGTAGCCAGTGGCTGCTGGG + Intergenic
953473148 3:43183787-43183809 CTGGGAAGAAAGGATCTGCTTGG - Intergenic
953580907 3:44155539-44155561 CTTGGTAGACAGTTGGTCCTTGG - Intergenic
954369278 3:50161798-50161820 CCTGGTACACAGCAGGTGCTGGG - Intronic
954538605 3:51379500-51379522 ATGGGCAGACAGGAAGGGCTGGG - Intronic
954626159 3:52023017-52023039 CAGGGCAGACAGGAGCTGCAGGG - Intergenic
954631405 3:52049644-52049666 CTGGGGAGACATTAGGTGGTGGG - Exonic
954790599 3:53130378-53130400 ATGGGCAGCCAGGAGGTGCTGGG - Exonic
956094940 3:65706455-65706477 CTTGGCACCCAGGAGGTGCTGGG - Intronic
957498748 3:81025931-81025953 CTGGAAAGACAGGAGGTGTTGGG + Intergenic
961069138 3:123905214-123905236 TTGGGGAGACAGGAAGTGATTGG + Intronic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961561819 3:127735644-127735666 ATGAGTAGACAGGAGGTGACTGG - Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
964464930 3:156981352-156981374 CAGGGTAGACTGGAGATGCAGGG + Intronic
965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG + Intergenic
965477399 3:169174029-169174051 AAGGGTAGACAGGATATGCTGGG - Intronic
967122997 3:186400247-186400269 CTGGATAGTGAGGAGGTCCTGGG - Intergenic
967135421 3:186508937-186508959 CTGGCTAGACAGCAGGAGCCAGG + Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967894637 3:194386033-194386055 CTGGGCACGTAGGAGGTGCTCGG - Intergenic
968486511 4:865634-865656 CAGGGCAGACAGGACCTGCTGGG - Intronic
968726650 4:2251000-2251022 CTGGGTGGAGAGGAGGTGCCTGG - Intronic
968905215 4:3447712-3447734 CTGGGCAGACATGTGGTGCGGGG + Intronic
969124443 4:4936014-4936036 CTGGGCACATAGGAGGTGCCAGG - Intergenic
969613206 4:8238314-8238336 CTGTCTGGAGAGGAGGTGCTGGG + Intronic
971026259 4:22591112-22591134 CTGTGTAGACAGGATCTTCTGGG + Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
971802402 4:31309008-31309030 CTAGGTAAACAGGAGATACTGGG - Intergenic
976056627 4:81076934-81076956 CTGGGTAGACTGGAACTGTTTGG - Intergenic
979195537 4:117916437-117916459 CTGGCTAACCAGGAGGTCCTGGG - Intergenic
979629553 4:122884803-122884825 TTGGGGTGAGAGGAGGTGCTGGG + Intronic
980041942 4:127950174-127950196 TTTGTTAGACAGGAAGTGCTAGG + Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985796515 5:1966206-1966228 CTGGGCTGACAGGTGCTGCTGGG + Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987661916 5:20888929-20888951 CTGGGCAGACAGGCCTTGCTGGG - Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
988761671 5:34316390-34316412 CTGGGCAGACAGGCCTTGCTGGG + Intergenic
989354659 5:40529943-40529965 TTGGGTAGAAATGATGTGCTGGG + Intergenic
989550266 5:42726746-42726768 CTTGGTGCACAGTAGGTGCTTGG - Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992138723 5:73773648-73773670 CCAGGTAGGCAGTAGGTGCTGGG - Intronic
996722953 5:126647852-126647874 CTGGGAAGAAAGTAGGAGCTAGG + Intergenic
997671546 5:135679053-135679075 CTGGGTAGGCAGGTGGGTCTTGG + Intergenic
998453239 5:142250688-142250710 CTGGGTAGTCCTGAGGAGCTTGG + Intergenic
998569915 5:143247719-143247741 ATGGATAGACAGTAGGTGGTCGG + Intergenic
999108677 5:149095761-149095783 CTGGGTAGCCAGGATGTTTTAGG - Intergenic
999254707 5:150203884-150203906 CTGAGGAGAGAGGAGGGGCTGGG - Intronic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
999912982 5:156226091-156226113 CTGGGGGGACAGGTGGTGTTTGG + Intronic
1001249316 5:170134292-170134314 CTGGGAAGAGAGGACATGCTTGG - Intergenic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002196140 5:177502621-177502643 GGGGATAGACAGGAGGTTCTGGG + Intronic
1002849578 6:981976-981998 CTGGGTTTACAGGAGATGTTGGG - Intergenic
1005275794 6:24216030-24216052 GTGGTTAGAAAGGAGGTGATGGG + Intronic
1006581263 6:35079072-35079094 CTGGGGAGCCAGGAGCTGGTGGG + Intronic
1006905457 6:37530291-37530313 ATGTGTATACAGCAGGTGCTTGG + Intergenic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1013391368 6:109689458-109689480 CAGGGTAGACTGGAAGTTCTAGG + Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1016013282 6:139160061-139160083 CTGGGGAGACAGGATAGGCTTGG + Intronic
1016285447 6:142467929-142467951 CTGGGTAGACAGGACTCTCTAGG + Intergenic
1016466487 6:144330571-144330593 CTGAGAAGAGAGGAAGTGCTTGG + Intronic
1016914076 6:149228494-149228516 CTGGGGAGCCAGGAGATGGTGGG - Intronic
1017515798 6:155154736-155154758 CTGGGGAGGGAGGAGGTGGTTGG + Intronic
1017592603 6:155993437-155993459 CTGGGCAGTCAAGAGGGGCTGGG + Intergenic
1018342703 6:162868419-162868441 CTGGGTAGACTGGGAGCGCTGGG + Intronic
1018640149 6:165897911-165897933 CTGGGTGGACATGAGGTGAGAGG - Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019868995 7:3741118-3741140 CTTGGTATACAGGAGGTGGCAGG - Intronic
1020105607 7:5421018-5421040 CTGGGAAGACAGGAGGGGACGGG + Intronic
1020112495 7:5455515-5455537 CAGGGAGGACAGGAGGGGCTGGG - Intronic
1020634330 7:10678078-10678100 CTAGGCAGACAGGAGGTGCTTGG - Intergenic
1021577307 7:22116178-22116200 ATGGCTAGACAGGGGGGGCTTGG + Intergenic
1022068213 7:26883161-26883183 CTGAGAAGACAAGAAGTGCTGGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023212001 7:37816072-37816094 CTAGGTAGACATGATGTGCTGGG + Intronic
1023781616 7:43661013-43661035 CAGGGTGGACAGGAAGTGCCAGG - Intronic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025028122 7:55534859-55534881 GTGGGAAGACAGGAGGCACTGGG - Intronic
1025280991 7:57626390-57626412 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1025303738 7:57839117-57839139 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1026100215 7:67378291-67378313 CTGGGCACACAGGAGCAGCTGGG + Intergenic
1026914501 7:74111864-74111886 CTGGGGAGCCAGGATGGGCTGGG + Intronic
1027052537 7:75029102-75029124 CTGGGAAGACAGGAAGGGCCAGG + Intronic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1030266422 7:107626514-107626536 CTAGGTAGAAAGGAGAAGCTAGG - Intronic
1030670043 7:112325748-112325770 CTGGGTAGACCTGACATGCTTGG + Intronic
1031227073 7:119052940-119052962 CTGAGTAGGGTGGAGGTGCTGGG + Intergenic
1032080231 7:128854976-128854998 CTGGCCAGGCAGGAGATGCTTGG + Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1034902415 7:154915639-154915661 CTGGGTGGAGAGGCGGTGCCAGG + Intergenic
1035080284 7:156210087-156210109 CCGGAGAGACAGTAGGTGCTTGG + Intergenic
1035268320 7:157704578-157704600 GTGGGGAGCCAGGAGGTGGTAGG - Intronic
1035290710 7:157837018-157837040 GTGGGTGGACAGGTGGTGGTGGG - Intronic
1035934604 8:3822479-3822501 CAGGATAGACAAGAGCTGCTAGG + Intronic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1036550706 8:9813008-9813030 CTGGGAAGAAAGGAAGGGCTGGG + Intergenic
1036701196 8:11015100-11015122 CTGGGTTGGGAGGAGGCGCTTGG + Intronic
1037065722 8:14574526-14574548 CTGAGCAGACAGGACTTGCTAGG + Intronic
1037760857 8:21740616-21740638 CTGGGTGGAGAGGAGGCACTGGG - Intronic
1039858554 8:41437060-41437082 CTGGGCAGACAGGAGGTAACTGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045407053 8:101877357-101877379 CTGGGTAGTCAGGGAATGCTGGG - Intronic
1046876449 8:119259918-119259940 CTGGGTTGACAGTAGATGGTAGG + Intergenic
1047268467 8:123331054-123331076 CTGGGATTACAGGAGGAGCTGGG + Intronic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1048801044 8:138193992-138194014 CTGGGTAGACAGGAGGCCCTGGG - Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1049933320 9:476603-476625 TTGGGAAGACAGGAGATCCTGGG - Intronic
1050036819 9:1445098-1445120 CTAGGAAAACAGGAGGTTCTTGG - Intergenic
1051680717 9:19605140-19605162 CTGGTTACGCAGGAGGAGCTAGG + Intronic
1053292980 9:36894257-36894279 CAGGGTGGGCAAGAGGTGCTGGG - Intronic
1053303668 9:36969242-36969264 CTGGGTGGGCCGGAGGAGCTGGG - Intronic
1053433638 9:38060437-38060459 CTGGGATTACAGGAAGTGCTGGG + Intronic
1054326242 9:63714101-63714123 TTAGGTGGACATGAGGTGCTAGG - Intergenic
1056556744 9:87695645-87695667 CTGCCTACACAGGAGGTGCTTGG - Intronic
1058000912 9:99863901-99863923 CTGCGTAGCAAGCAGGTGCTAGG - Exonic
1059408741 9:114118722-114118744 CTGGGGACACTGGAGGTGCTGGG + Intergenic
1059468849 9:114488280-114488302 CAGGGCGCACAGGAGGTGCTTGG + Intronic
1060887110 9:127162155-127162177 CTGAGCACACAGGAGCTGCTTGG - Intronic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061081062 9:128370638-128370660 CTGAGTAGACTGGACTTGCTGGG - Intergenic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061772185 9:132934193-132934215 TAGGGAAGACGGGAGGTGCTTGG - Intronic
1062039681 9:134398538-134398560 CTGTGTAAACAGGAAGGGCTGGG + Intronic
1062449306 9:136608902-136608924 CTGGGAAAACAGGAGCTGCGGGG + Intergenic
1062595970 9:137299421-137299443 CTGGGCACGCTGGAGGTGCTGGG + Intergenic
1187330904 X:18338615-18338637 TAGGTTAGACAGGAGGGGCTGGG + Intronic
1189461916 X:41250068-41250090 CTGGGTAGACTGGCCGTGCTGGG + Intergenic
1190232068 X:48590031-48590053 CTTGGTAGATAGGAGGTGAATGG - Intronic
1192988701 X:76428120-76428142 GTGGGCAGAACGGAGGTGCTTGG - Exonic
1194843172 X:98770278-98770300 CTGGGTAGACATGAAGTTTTGGG + Intergenic
1196458673 X:115907611-115907633 CTGGGTTGTCTGTAGGTGCTGGG - Intergenic
1196631933 X:117951761-117951783 CTTAGTACACAGCAGGTGCTGGG - Intronic
1196746647 X:119077149-119077171 CTGGCTCGACAGGAGGTGCTCGG - Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1199103690 X:143837435-143837457 CTGGCTAGGCAAGAGGTCCTTGG + Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1199274123 X:145922366-145922388 CAGGCAATACAGGAGGTGCTTGG + Intergenic
1199303659 X:146241703-146241725 CTGGATACACTGGAGGTGCAAGG + Intergenic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic
1201161511 Y:11170589-11170611 CTTGGGAGACAGGAGCTACTTGG - Intergenic