ID: 986707440

View in Genome Browser
Species Human (GRCh38)
Location 5:10463544-10463566
Sequence TGGGGTCCCTGAGGTCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986707435_986707440 -7 Left 986707435 5:10463528-10463550 CCAGCCCCAAGGGAGATGGGGTC 0: 1
1: 1
2: 0
3: 18
4: 202
Right 986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG No data
986707431_986707440 0 Left 986707431 5:10463521-10463543 CCAGGCTCCAGCCCCAAGGGAGA 0: 1
1: 1
2: 2
3: 42
4: 427
Right 986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG No data
986707427_986707440 9 Left 986707427 5:10463512-10463534 CCAGGTCCTCCAGGCTCCAGCCC 0: 1
1: 0
2: 8
3: 103
4: 734
Right 986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG No data
986707429_986707440 3 Left 986707429 5:10463518-10463540 CCTCCAGGCTCCAGCCCCAAGGG 0: 1
1: 1
2: 2
3: 60
4: 549
Right 986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG No data
986707426_986707440 10 Left 986707426 5:10463511-10463533 CCCAGGTCCTCCAGGCTCCAGCC 0: 1
1: 1
2: 3
3: 64
4: 567
Right 986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986707440 Original CRISPR TGGGGTCCCTGAGGTCTTCC CGG Intronic
No off target data available for this crispr