ID: 986709888

View in Genome Browser
Species Human (GRCh38)
Location 5:10480927-10480949
Sequence CAGTTTGAGCAGGGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986709875_986709888 20 Left 986709875 5:10480884-10480906 CCACCCACAGCTCTTTCCAGTGG No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709873_986709888 25 Left 986709873 5:10480879-10480901 CCTGCCCACCCACAGCTCTTTCC No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709879_986709888 4 Left 986709879 5:10480900-10480922 CCAGTGGATCCAACTTCCTCTCA No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709877_986709888 17 Left 986709877 5:10480887-10480909 CCCACAGCTCTTTCCAGTGGATC No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709874_986709888 21 Left 986709874 5:10480883-10480905 CCCACCCACAGCTCTTTCCAGTG No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709878_986709888 16 Left 986709878 5:10480888-10480910 CCACAGCTCTTTCCAGTGGATCC No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709872_986709888 26 Left 986709872 5:10480878-10480900 CCCTGCCCACCCACAGCTCTTTC No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data
986709880_986709888 -5 Left 986709880 5:10480909-10480931 CCAACTTCCTCTCACACCCAGTT No data
Right 986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986709888 Original CRISPR CAGTTTGAGCAGGGGGAGAC AGG Intergenic
No off target data available for this crispr