ID: 986712972

View in Genome Browser
Species Human (GRCh38)
Location 5:10501341-10501363
Sequence TCCAGGGACCCTCACAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986712972_986712977 2 Left 986712972 5:10501341-10501363 CCTCTTCTGTGAGGGTCCCTGGA 0: 1
1: 0
2: 3
3: 42
4: 273
Right 986712977 5:10501366-10501388 CAGTGGCTGCTCCCTGCAGGAGG 0: 1
1: 0
2: 1
3: 51
4: 436
986712972_986712976 -1 Left 986712972 5:10501341-10501363 CCTCTTCTGTGAGGGTCCCTGGA 0: 1
1: 0
2: 3
3: 42
4: 273
Right 986712976 5:10501363-10501385 AAACAGTGGCTGCTCCCTGCAGG 0: 1
1: 0
2: 2
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986712972 Original CRISPR TCCAGGGACCCTCACAGAAG AGG (reversed) Intergenic
905325904 1:37151846-37151868 TCCTCGGACCCTCACAGAGGAGG - Intergenic
907240020 1:53076102-53076124 CCCAGGGGCCCTAACAGAGGAGG + Intronic
910275927 1:85449175-85449197 ATCAGGGGCCCCCACAGAAGGGG + Intronic
910837641 1:91531844-91531866 TCCTGGGCCCTTCACAGAGGAGG - Intergenic
913224238 1:116684868-116684890 TCCAGGGAGCCTAAATGAAGTGG - Intergenic
915623981 1:157103394-157103416 ACCAGGGACTCTCACAGACACGG - Intergenic
915913203 1:159926976-159926998 TCCCTGGACCCTTAAAGAAGAGG - Intergenic
916317599 1:163467611-163467633 TCCCAGGATCCTCACAAAAGGGG - Intergenic
916561323 1:165936156-165936178 TCCAGGGTCACTCAGAGAAGTGG + Intergenic
916766089 1:167862116-167862138 TCAAGGAGCTCTCACAGAAGAGG - Intronic
920791746 1:209099400-209099422 TCCAGAGAACTTCACAGGAGAGG + Intergenic
922600861 1:226851836-226851858 CCCAGGGACTATCGCAGAAGAGG + Intergenic
922788848 1:228298566-228298588 TCCTGAGACCCTCAGAGATGGGG + Exonic
923121650 1:230997918-230997940 TCCAGTGACCCTCCCATCAGAGG + Intronic
1065338585 10:24680659-24680681 TCTATGGGCCTTCACAGAAGCGG + Intronic
1067158765 10:43804714-43804736 CCCAGGGAAGATCACAGAAGGGG + Intergenic
1067408939 10:46047928-46047950 TCCTTGGACCCTCTCTGAAGAGG - Intergenic
1068097267 10:52507070-52507092 CCCAGGGACTATCACAGAAGAGG - Intergenic
1068419170 10:56767014-56767036 CCCAGGGACTATCACAGAAGAGG - Intergenic
1071470105 10:85978054-85978076 TCCAGGGATCCTCACATACCTGG + Intronic
1071689447 10:87800854-87800876 CCCAGGGACTATCATAGAAGAGG + Intronic
1071898369 10:90089984-90090006 CCCAGGGACTATCTCAGAAGAGG + Intergenic
1073859543 10:107721875-107721897 TCTTGGGAACCTCATAGAAGTGG + Intergenic
1075645820 10:124095351-124095373 TCCACACACCCTTACAGAAGGGG - Intergenic
1078549899 11:12272783-12272805 ATCAGGGACCCTGACTGAAGGGG + Intergenic
1078697172 11:13646079-13646101 CTCAGGGACCATCACAGAAGAGG - Intergenic
1079260387 11:18872934-18872956 TCCAAGCACACTGACAGAAGAGG - Intergenic
1079428163 11:20363652-20363674 TCCTGGCACCCTCACAGGCGCGG - Intergenic
1080403627 11:31959251-31959273 TCCAGGGACACTGGCAGATGAGG + Intronic
1081082069 11:38754426-38754448 CCCAGAGACTATCACAGAAGAGG - Intergenic
1081122314 11:39282912-39282934 CCCAGGGACAATCTCAGAAGAGG + Intergenic
1082949324 11:58794111-58794133 CCCAGGGACCATCATGGAAGAGG - Intergenic
1083900293 11:65640353-65640375 TCCAGGGACCCTGAAGGAAGTGG + Intronic
1084358888 11:68657025-68657047 TGCTGGGACCCTCCCAGAAGGGG + Intergenic
1089015558 11:115162395-115162417 TGCAGGCAGCCTCACAGAGGAGG - Intergenic
1089745520 11:120614224-120614246 TCCTGGGAACCACACAGAAAGGG + Intronic
1090100462 11:123790648-123790670 CCCAGGGACTGTCACAGGAGAGG - Intergenic
1092112276 12:5972043-5972065 TCTAGGGACCCTCACTGACCGGG + Intronic
1092305328 12:7294782-7294804 CCCAGTGACTATCACAGAAGAGG + Intergenic
1093276635 12:17136883-17136905 TTAGGGGACCCCCACAGAAGTGG - Intergenic
1093708334 12:22300317-22300339 TCCAGGGACTATTGCAGAAGAGG + Intronic
1097031790 12:56095063-56095085 TCAAGGGAGTTTCACAGAAGAGG + Intronic
1097343036 12:58461277-58461299 TCCATGAACCCACCCAGAAGTGG - Intergenic
1098408771 12:70155962-70155984 CCCAGGGACTATCACAGAAGAGG + Intergenic
1099874358 12:88386328-88386350 CCCAGGGACTATCATAGAAGTGG - Intergenic
1101935529 12:109053291-109053313 ATCAGGGACCCAGACAGAAGTGG - Intronic
1102346130 12:112162559-112162581 CCCTGGGAGCCTCACAGATGTGG - Intronic
1103902120 12:124308772-124308794 TGCAGAGGCCCTCAGAGAAGAGG - Intronic
1104127296 12:125860743-125860765 TCCAAGAACCCTTACGGAAGAGG - Intergenic
1104935990 12:132364759-132364781 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936000 12:132364794-132364816 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936009 12:132364829-132364851 TCCAGGGCCACTCACAGGCGGGG + Intergenic
1104936020 12:132364864-132364886 TCCAGGGCCACTCACAGGCGGGG + Intergenic
1104936031 12:132364899-132364921 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936041 12:132364934-132364956 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936051 12:132364969-132364991 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936061 12:132365004-132365026 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936071 12:132365039-132365061 TCCAGGGTCACTCACAGGCGGGG + Intergenic
1104936081 12:132365074-132365096 TCCAGGGCCACTCACAGGCGGGG + Intergenic
1104955754 12:132465133-132465155 TGTAGGAACACTCACAGAAGAGG + Intergenic
1106105332 13:26728127-26728149 TCCAGGGACCCACCCACAATGGG + Intergenic
1106200355 13:27531366-27531388 TCAAAGGACACTCACAGAATGGG - Intergenic
1107751220 13:43569539-43569561 CCCAGTGACACTCTCAGAAGAGG + Intronic
1108257567 13:48625445-48625467 TGCAGGGACTATCCCAGAAGAGG + Intergenic
1109012506 13:56969955-56969977 TCCAAGGTTCCACACAGAAGAGG - Intergenic
1112413455 13:99184090-99184112 CCCAGGGACTATCACAGAAGAGG - Intergenic
1113941158 13:114019193-114019215 TCCGGGAACCGGCACAGAAGTGG + Intronic
1114358417 14:21941403-21941425 GCCAGTGACTCTCTCAGAAGAGG + Intergenic
1114504835 14:23202432-23202454 CCCAGGGACTATCACGGAAGAGG - Intronic
1115656151 14:35445609-35445631 TCATAAGACCCTCACAGAAGAGG - Intergenic
1116660463 14:47704071-47704093 CTCAGGGACTATCACAGAAGAGG + Intergenic
1117187644 14:53257401-53257423 TCCAGGGACTATCACAGAAGAGG - Intergenic
1117339122 14:54778864-54778886 CCCAGGATCCCTCACTGAAGGGG + Intronic
1117405991 14:55404626-55404648 TCCAGGAATCTTCACACAAGTGG + Intronic
1118510677 14:66469305-66469327 CCCAGGGACTATCACAGAAAAGG + Intergenic
1119642318 14:76324506-76324528 TCGAGGGACCCCCACAGAGAGGG - Intronic
1119858824 14:77922134-77922156 TCCAAAGAGCCTCACAGAAGAGG + Intronic
1121272151 14:92645000-92645022 GCCAGGGACCCTCTGAGAAATGG + Intronic
1123175503 14:106413939-106413961 CCCAGGGACTATTACAGAAGTGG - Intergenic
1125174288 15:36803045-36803067 GCCAGGGACTCTCACAGTTGGGG + Intronic
1128319859 15:66685526-66685548 GCCAGGGAAGCCCACAGAAGAGG - Exonic
1128514143 15:68331740-68331762 TCCAGGCCCTCTCACAGAAACGG - Intronic
1130658530 15:85811116-85811138 TCCAGCAACCCTCACGGAAATGG - Intergenic
1130966406 15:88700879-88700901 AGCAGGGACCCTCAGAGAATAGG + Intergenic
1132520152 16:383425-383447 TCCAGGTACGTTCACGGAAGTGG + Intronic
1132642438 16:983977-983999 TACAGGGACCCTCAGATATGCGG - Intronic
1132948053 16:2543511-2543533 GCCTGGGCCCCTCACAGAGGAGG - Intronic
1132966394 16:2657831-2657853 GCCTGGGCCCCTCACAGAGGAGG + Intergenic
1133167528 16:3958615-3958637 TCAAGGAACCAACACAGAAGTGG + Intronic
1134838815 16:17384373-17384395 TTCAGGGGCCCTCAGAAAAGAGG + Intronic
1135598127 16:23758801-23758823 TCAAGGGTCCCTCACAGTAATGG - Exonic
1136866051 16:33755546-33755568 TCCTGGTAACTTCACAGAAGAGG + Intergenic
1137620077 16:49870201-49870223 TCCAGGGACCTGCCCAGGAGAGG - Intergenic
1137668543 16:50266100-50266122 TCCTGGGCCCCTCTCAGAGGTGG + Intronic
1138282217 16:55780655-55780677 TGCAAAGACCCTGACAGAAGGGG + Intergenic
1138286727 16:55815979-55816001 TGCAAAGACCCTGACAGAAGGGG - Intronic
1139206448 16:65033777-65033799 TCCATAGACCCTCACAGTACTGG - Intronic
1140419783 16:74808920-74808942 TCCAGGGAGTATCACAGAAGAGG + Intergenic
1142056989 16:88004180-88004202 CCCAGGGACCCGCACTGAGGGGG - Intronic
1142144468 16:88487155-88487177 TCCAGAGACCCTGGGAGAAGGGG + Intronic
1203106103 16_KI270728v1_random:1360557-1360579 TCCTGGTAACTTCACAGAAGAGG - Intergenic
1203127411 16_KI270728v1_random:1601811-1601833 TCCTGGTAACTTCACAGAAGAGG + Intergenic
1143408186 17:6691876-6691898 TCTTGGGGCCCTCAGAGAAGTGG + Intronic
1143590331 17:7882321-7882343 TCCACAGACACACACAGAAGGGG + Intronic
1146441661 17:32901435-32901457 CCCAGGGACTATCACAGAAGAGG - Intergenic
1147584912 17:41648492-41648514 TCCAGGGACCCTCAGACTCGGGG - Intergenic
1147604989 17:41769399-41769421 AGCAGGGACCCTCACAGACCGGG + Exonic
1148162889 17:45461715-45461737 TGCAGGGGCCTGCACAGAAGTGG - Intronic
1148494528 17:48045389-48045411 GCCAGGAATCCTCAGAGAAGGGG - Intergenic
1148891178 17:50808534-50808556 TACTGGGACCCTCAGAAAAGGGG + Intergenic
1149046992 17:52257491-52257513 CTCAGGGACCATCACAGAAGAGG + Intergenic
1150195153 17:63290235-63290257 TCCAGGGGCACTCAGAGATGGGG - Intronic
1150373631 17:64662298-64662320 TCCCGGGTCCCTCAGACAAGAGG - Intergenic
1151478347 17:74356043-74356065 CCCAGGCACCCTCCCAGGAGAGG + Intergenic
1151785900 17:76274937-76274959 TCCAGGGCCCCCCACAGACCAGG - Intronic
1151938568 17:77279400-77279422 TCCAGGAACCATCACACAGGAGG + Intergenic
1153156959 18:2160742-2160764 CCCAGGGACTATCACAGAAGAGG + Intergenic
1154453132 18:14495976-14495998 TCATTGGACACTCACAGAAGGGG - Intergenic
1157730342 18:49998784-49998806 TCTAGGTACCCCCACACAAGTGG - Intronic
1157736187 18:50051798-50051820 TCCCAGGTACCTCACAGAAGTGG - Intronic
1158350619 18:56561818-56561840 TCCTGGGATGCTCAAAGAAGAGG - Intergenic
1158716581 18:59885711-59885733 TCCTGGGACCCTGAAAGGAGAGG + Intergenic
1159198572 18:65151151-65151173 CCCAGGGACCTCCACAGAAGAGG - Intergenic
1159390567 18:67787807-67787829 TGCAGGGAGCCACACAGCAGAGG - Intergenic
1159393956 18:67831709-67831731 TGCAGGGGACTTCACAGAAGAGG - Intergenic
1160266339 18:77343002-77343024 CCCTGGGACCCTCACAGAGCTGG - Intergenic
1161169828 19:2807200-2807222 CCGAGGGACCCTTACAGAACAGG + Intronic
1161396702 19:4048302-4048324 CCCAGGGACCCTCACGGACACGG + Intronic
1161638898 19:5407203-5407225 TCCAGAGAGCCTCAAAGATGAGG + Intergenic
1163460666 19:17435654-17435676 TCCGGGGACCCCCACACAATAGG - Exonic
1163605693 19:18274198-18274220 TCCTTGGCCCCTCACAGCAGGGG - Intronic
1164407059 19:27959441-27959463 CTCAGGGAATCTCACAGAAGAGG - Intergenic
1164771348 19:30811797-30811819 TCCAGGGACCCTGGCTGATGGGG - Intergenic
1165102417 19:33446781-33446803 TCCTGGGACCCTATCAGCAGAGG - Intronic
1165983905 19:39750842-39750864 TCCAGGGAGCATCACACAATTGG + Intergenic
1166872889 19:45881800-45881822 TCCAGAGAGCCTCAGAGATGAGG - Intergenic
1167696848 19:51019854-51019876 TCCAGGGCCCCTCCCAGAGCAGG - Exonic
926162928 2:10501189-10501211 ACCAGGGGACCGCACAGAAGTGG - Intergenic
926457502 2:13085409-13085431 TTCAGGAACTATCACAGAAGAGG + Intergenic
927911631 2:26903933-26903955 TCTCTGGACCCTCACGGAAGAGG - Intronic
928417173 2:31105405-31105427 ACCAGGGGGCCTCAGAGAAGTGG - Intronic
929054014 2:37860561-37860583 TCCAGGGGGTTTCACAGAAGTGG + Intergenic
929079163 2:38105686-38105708 TCCAGGGAACCTCACTGTATTGG - Intronic
934612812 2:95753441-95753463 TCCAGAGAGCCTCACGGAAGGGG - Intergenic
934648098 2:96070981-96071003 TCCAGCGAGCCTCATGGAAGGGG + Intergenic
934841473 2:97626804-97626826 TCCAGCGAGCCTCATGGAAGGGG + Intergenic
937467173 2:122143758-122143780 TCCAGGGACTTACAGAGAAGAGG - Intergenic
939339454 2:140875174-140875196 CCCAGGAACTATCACAGAAGAGG + Intronic
942230052 2:173852531-173852553 GACAGGGATGCTCACAGAAGTGG - Intergenic
944405637 2:199380527-199380549 ACCAGGGTCCCTGACTGAAGAGG + Intronic
945041983 2:205749941-205749963 TCCAGGGGATCTCAAAGAAGTGG + Intronic
945968477 2:216213047-216213069 CCCATGGACTATCACAGAAGGGG - Intergenic
946909160 2:224443080-224443102 TGAAGAGACCCTCAGAGAAGCGG + Intergenic
947144221 2:227049816-227049838 TGCTGGGACTCTCACAGAGGAGG + Intronic
949029185 2:241782260-241782282 CCCAGGGACAATCACAGAAGAGG - Intronic
1169922029 20:10745257-10745279 TCAAGGGCCCCACACGGAAGTGG - Intergenic
1171425086 20:25043958-25043980 TACAGAGACCCTCAGAGAAGAGG + Intronic
1174281190 20:49440802-49440824 TCCAGAGACTCTCAGAAAAGAGG + Intronic
1174721301 20:52815690-52815712 TCCAGAGAGCATCCCAGAAGTGG - Intergenic
1175198712 20:57264197-57264219 TCCAGGGACCTTATCAGGAGGGG + Intronic
1175275078 20:57762912-57762934 ACGAGGGAACCTCAGAGAAGAGG + Intergenic
1175357764 20:58382394-58382416 TCCAGGGATTCTCACAGATAAGG + Intergenic
1175766760 20:61597714-61597736 TTCAGCGACTCTCACAGGAGAGG + Intronic
1176301808 21:5102181-5102203 CCAAGGGACCCTCACAGATGAGG - Intergenic
1176442899 21:6792273-6792295 TCATTGGACACTCACAGAAGGGG + Intergenic
1176674129 21:9761437-9761459 TCCAGGGAATTTCCCAGAAGTGG + Intergenic
1176821055 21:13657287-13657309 TCATTGGACACTCACAGAAGGGG + Intergenic
1177705323 21:24696690-24696712 TTCAAGGAACCTCACACAAGTGG - Intergenic
1178279751 21:31271385-31271407 TCCAGGCATCCTGAGAGAAGAGG - Intronic
1178386504 21:32155336-32155358 TCCAGGGACTATCGCAGAAGAGG - Intergenic
1178471669 21:32899123-32899145 TCCAGGGACCTTCCCTGAAAAGG + Intergenic
1178828675 21:36036521-36036543 TTCCAGGAACCTCACAGAAGTGG + Intronic
1179175818 21:39007158-39007180 CCCACGGCCCCTCACAGAGGGGG + Intergenic
1179315951 21:40244659-40244681 TTCATGGTCCCTCACAGCAGTGG + Intronic
1179772371 21:43631820-43631842 GTCAGGGAACTTCACAGAAGGGG - Intronic
1179855223 21:44159719-44159741 CCAAGGGACCCTCACAGATGAGG + Intergenic
1181185720 22:21102307-21102329 TCCAGAGCTCCCCACAGAAGTGG - Intergenic
1182124962 22:27809700-27809722 TCCAGGGAGCCTTAGAGAGGAGG - Intergenic
1183616421 22:38948536-38948558 TCCAGGAAGCTGCACAGAAGGGG + Intergenic
1184381726 22:44148990-44149012 CCCAGGGACCCTGACAGAACCGG + Intronic
1184660493 22:45963446-45963468 TCCAGGGGCCTTGACTGAAGTGG + Intronic
950600088 3:14027050-14027072 CCCAGGGACTATCACAGAAGAGG - Intronic
950796582 3:15515371-15515393 CCCAGGACCCCTCACAGTAGGGG + Intronic
950975529 3:17238821-17238843 TCATGGGGTCCTCACAGAAGGGG + Intronic
951277744 3:20710519-20710541 TCCAGGCACCCCCAAAGGAGAGG + Intergenic
951308370 3:21094981-21095003 CCCAGGGACTATCCCAGAAGAGG - Intergenic
951677932 3:25263050-25263072 TCTAGGGATCAGCACAGAAGGGG + Intronic
952757472 3:36884339-36884361 ACCAGGGATCCTTAGAGAAGTGG + Intronic
954459150 3:50616881-50616903 ACCCGGGACCCGCACAGTAGCGG + Intronic
955167625 3:56529863-56529885 TCAAGTGATCCTCCCAGAAGTGG - Intergenic
955620970 3:60863647-60863669 CCCAGGGACCATCAAAGAGGAGG - Intronic
959504121 3:107139252-107139274 CTCAGGGACCATCACAGAAGAGG + Intergenic
959980522 3:112511401-112511423 CCCTGGGACTATCACAGAAGAGG - Intergenic
960809412 3:121613778-121613800 TCCAGTGTCCCTCAGACAAGTGG + Intronic
963676509 3:148317972-148317994 TCTTGGGAACCTCACAGAAATGG + Intergenic
967103593 3:186237282-186237304 TCCAGGGCCCCACACTTAAGAGG + Intronic
967444167 3:189545261-189545283 TCCAGAGACTATCACAGAAGAGG - Intergenic
968043360 3:195607793-195607815 GCCAGGGACTATCAGAGAAGAGG + Intergenic
968554811 4:1241583-1241605 TCCAGGGAACGCCTCAGAAGTGG + Intronic
968643346 4:1726131-1726153 CGCAGGGCCCCTGACAGAAGAGG - Intronic
968961493 4:3747112-3747134 ACCAGGGCTCCTCAGAGAAGTGG + Intergenic
969727595 4:8931693-8931715 CCCAGGGACTATCACAAAAGAGG + Intergenic
969761862 4:9191769-9191791 TACAGGTAACCACACAGAAGTGG + Intergenic
971913381 4:32826002-32826024 CCCAGGGACTATCACCGAAGAGG - Intergenic
972853566 4:43078877-43078899 TCCAGGGATGATCACAGAAGAGG - Intergenic
973964861 4:56151861-56151883 TCCCAGGAATCTCACAGAAGAGG + Intergenic
974494819 4:62614104-62614126 GCCTGGGACCCTCCCAGAACAGG + Intergenic
974495195 4:62616692-62616714 CCCTGGGACCCTCCCAGAACAGG - Intergenic
974948369 4:68556461-68556483 TCCAGGGACTATCACAGAAGAGG + Intronic
974957394 4:68658868-68658890 TCCAGGGACTATCACAGAAGAGG + Intronic
974974506 4:68873468-68873490 TCCAGGGACTACCACAGAAATGG + Intergenic
975514379 4:75229855-75229877 TCCAAGGACACTTTCAGAAGTGG - Intergenic
978751826 4:112258515-112258537 TCTAGGGAACCTTAGAGAAGAGG + Intronic
980237527 4:130128894-130128916 ACCAGGGAACCTCAGAGAAGTGG + Intergenic
980280424 4:130711633-130711655 TACAGGGACCCTCACTTAACAGG + Intergenic
980897373 4:138872882-138872904 TCCAGGACCCTTCAGAGAAGAGG + Intergenic
980936738 4:139233038-139233060 TCCAGTGTCACTCTCAGAAGTGG - Intergenic
981483870 4:145264366-145264388 GCCAAGGACCCACACAGCAGTGG - Intergenic
985567182 5:625013-625035 TCCCGGCACCGTCACAGAAAGGG - Intronic
986712972 5:10501341-10501363 TCCAGGGACCCTCACAGAAGAGG - Intergenic
987211834 5:15691649-15691671 TCCAAGCACCGTCACAGCAGGGG + Intronic
987285774 5:16454923-16454945 TCCAGGCTCCCTCAGAGCAGTGG + Intronic
987331406 5:16860715-16860737 TCCAGGGCCTCTGACAGATGAGG + Intronic
988778016 5:34494686-34494708 TCCAGAGACACTCAAAGAAGAGG - Intergenic
990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG + Intergenic
990031135 5:51261068-51261090 TCCAGGGTATCTCACATAAGTGG + Intergenic
990965689 5:61444769-61444791 CCCAGGGAGTATCACAGAAGAGG - Intronic
991575343 5:68097499-68097521 ACCAGGGACCATTAGAGAAGTGG + Intergenic
992289034 5:75265748-75265770 TCAAGGGACCCTTAGAGACGTGG - Intergenic
992416767 5:76559411-76559433 TCCTGGCAGCCTCACCGAAGAGG - Intronic
994095434 5:95843350-95843372 TCCTGTGACCCTCACCAAAGAGG - Intergenic
994883844 5:105532181-105532203 TCCAGGGACACTCACATCAGAGG + Intergenic
996367901 5:122722271-122722293 TCCAGTGTCCATCACAGATGAGG + Intergenic
997122109 5:131185335-131185357 TTCAAGGACCCTCAAAGAAGGGG - Intronic
997282417 5:132657079-132657101 TCCAGAAACCCCCACAGCAGAGG - Intronic
999168018 5:149567828-149567850 ACCAGGGATCCTCAAAGAAATGG - Intronic
999438168 5:151580561-151580583 TTAAGGGACCCTCCCACAAGGGG - Intergenic
999636479 5:153628173-153628195 GACTGGGACTCTCACAGAAGAGG + Intronic
1000367850 5:160507526-160507548 GCCAGAGACCCTCACAGAGAAGG + Intergenic
1000973974 5:167744680-167744702 TCAAGACACCCTCAGAGAAGGGG + Intronic
1001312202 5:170619231-170619253 CCCAGTGCCCCACACAGAAGAGG + Intronic
1001659192 5:173377963-173377985 TCCAGGGAAGCTCACAGAACTGG - Intergenic
1002061403 5:176627994-176628016 CCCAGGGACCCACACAGACAAGG + Intronic
1004119179 6:12803364-12803386 TCCACAGCCCCTCACAGAAAAGG + Intronic
1005044432 6:21628670-21628692 TACACAGACCCACACAGAAGTGG + Intergenic
1006633742 6:35447565-35447587 TCGAGTGACTCTTACAGAAGGGG + Intergenic
1007610098 6:43143613-43143635 TCCAGGGCCCCTCACCGTTGAGG - Exonic
1011122823 6:83972849-83972871 CCCAGGGACTATCACAGAAGTGG - Intergenic
1012693998 6:102354693-102354715 TCCTGGGACCTTAAGAGAAGAGG - Intergenic
1014258966 6:119194571-119194593 ACCTGGGCCTCTCACAGAAGAGG + Intronic
1015625013 6:135172314-135172336 TCTTGGGCCCTTCACAGAAGTGG - Intergenic
1017351345 6:153445736-153445758 CCCAGGGACTATCACAGAAGAGG - Intergenic
1018145761 6:160886679-160886701 CCCAGGGACTATCACAGAAGAGG + Intergenic
1018445492 6:163854406-163854428 CCCTGGGACCCTCATGGAAGTGG + Intergenic
1019746566 7:2703537-2703559 ACCAGCGACCCTCAGGGAAGGGG - Intronic
1019775580 7:2910209-2910231 TGCAGGCACCTTCACAGGAGCGG - Intronic
1020244528 7:6420496-6420518 TTCTGGGAACCCCACAGAAGTGG - Intronic
1020500112 7:8907587-8907609 TGCAGGGACCATCACAGACATGG + Intergenic
1022030484 7:26487834-26487856 TCCCGGGACCCTCCAAGTAGTGG - Intergenic
1022107377 7:27206073-27206095 TCCAGGGACTCTCACTGAGCGGG + Intergenic
1023864226 7:44231288-44231310 CCCAGGGACCAGCACAGAACTGG - Intronic
1026741324 7:72980506-72980528 ACCAGGGATCCTCAGAGGAGAGG - Intergenic
1026801161 7:73400839-73400861 ACCAGGGATCCTCAGAGGAGAGG - Intergenic
1027102410 7:75384572-75384594 ACCAGGGATCCTCAGAGGAGAGG + Intergenic
1027748380 7:82107983-82108005 TCCAGGGTCACTCACTGAAAAGG + Intronic
1029339646 7:99932733-99932755 TGCAGGTATCCTCACAGATGGGG - Intergenic
1030075880 7:105736131-105736153 TCCTGGGAAGCCCACAGAAGAGG - Intronic
1031284287 7:119844218-119844240 TCCTGAGACCTTCACAGAAGTGG + Intergenic
1031661825 7:124435397-124435419 TCCAGGGACTATTGCAGAAGAGG - Intergenic
1032079068 7:128849676-128849698 CCCAGGAGCCCTCAGAGAAGTGG - Intronic
1033705278 7:143880740-143880762 TCAAGGGACCCCCATAGAGGAGG - Intronic
1035010997 7:155714828-155714850 TCCTGGGACCCTCCCATACGTGG + Intronic
1035382586 7:158449094-158449116 TCCAGGGACTTTCACACCAGAGG + Intronic
1035882765 8:3260291-3260313 GCCAGGGAGCCTCACAGAGGTGG - Intronic
1036349382 8:7996742-7996764 TACAGGTAACCACACAGAAGTGG - Intergenic
1037335365 8:17786407-17786429 CCCAGGCACCATCTCAGAAGTGG + Intronic
1037473957 8:19237908-19237930 TTCAGGGAGGGTCACAGAAGAGG + Intergenic
1038058800 8:23889344-23889366 TCCAGGGTCTCTGACAAAAGGGG + Intergenic
1039022666 8:33224723-33224745 CTCTGGGAACCTCACAGAAGTGG + Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040884560 8:52246637-52246659 TTCAGGGACACTCACAAAATTGG + Intronic
1042670385 8:71256476-71256498 TGCAGGTACCCTCATATAAGTGG - Intronic
1042689905 8:71486307-71486329 TCCTGGGAGGCACACAGAAGAGG + Intronic
1042933378 8:74034782-74034804 CCCGGGGACTGTCACAGAAGGGG + Intergenic
1044562695 8:93628404-93628426 TCCAGGAGACCTCACAGAATTGG - Intergenic
1044814582 8:96098343-96098365 TCCATGGGACCTCAAAGAAGAGG + Intergenic
1047997419 8:130349985-130350007 TCCAGGGAGCCTCAGAGAGATGG - Intronic
1049392912 8:142381306-142381328 TCCTGGGACCATCACAGAGTGGG - Intronic
1050174585 9:2856449-2856471 TCCAGTGACCCTCACAGGCCAGG + Intergenic
1052206794 9:25851852-25851874 TGCAGGGACTATCGCAGAAGAGG + Intergenic
1052449885 9:28615220-28615242 TCCATGGGCCCTCTAAGAAGTGG - Intronic
1053075536 9:35130799-35130821 CCCAAGGACTATCACAGAAGAGG + Intergenic
1054774599 9:69114651-69114673 TCAAGGGAGCCTCACTGAATAGG + Intergenic
1055461930 9:76527802-76527824 TCCAGGCACCTTCAGAGAAATGG - Intergenic
1056403162 9:86247998-86248020 TCAAGGGACCCTCCCACAAAGGG - Intronic
1057129433 9:92642706-92642728 TCCAGGGAACCTGACACAAGGGG + Intronic
1057218846 9:93244818-93244840 TCTAGGGAGCCTCAGAGAACGGG - Intronic
1057816116 9:98296270-98296292 TCCAGGTGCCATCTCAGAAGTGG + Intronic
1058446223 9:105057678-105057700 CCCAGGGACTATCACAGAAAAGG + Intergenic
1060781904 9:126419112-126419134 TTCAGGGAGGCTCACAGAGGAGG - Intronic
1203526304 Un_GL000213v1:92258-92280 TCATTGGACACTCACAGAAGGGG - Intergenic
1186077187 X:5893298-5893320 TCTAAGGACCCTCACAAAACAGG - Exonic
1191202751 X:57802424-57802446 TCCTGGGTCCCTCCCAGAACAGG - Intergenic
1191624854 X:63259667-63259689 CCCAGGGACTATCACAGAAGAGG - Intergenic
1192234984 X:69289914-69289936 TCCAGTGTCCCTCACAGCATGGG - Intergenic
1192676278 X:73199892-73199914 TCCAGGGACTATCGCAGAAGAGG + Intergenic
1193973835 X:88092334-88092356 CCAAGGGACTATCACAGAAGAGG - Intergenic
1194008745 X:88531712-88531734 CCCAGGGACTATCACAGAAGAGG - Intergenic
1195225731 X:102791173-102791195 CCCAGGGACTATCGCAGAAGAGG - Intergenic
1195894632 X:109733124-109733146 TCCAGGGATACTCACCGGAGGGG + Exonic
1197303931 X:124817478-124817500 TCCTGGGATTCTCACAGTAGTGG + Intronic
1198952357 X:142086189-142086211 CCCAGGGACTATCACGGAAGAGG + Intergenic
1199160495 X:144604690-144604712 CCCAGGGACTATCACAGAAGAGG - Intergenic
1199186011 X:144916166-144916188 CCCAGGGACTATTACAGAAGAGG - Intergenic
1199498600 X:148483805-148483827 ACCAGGAACTCTCAAAGAAGTGG + Intergenic
1199869392 X:151884016-151884038 CCCAGGGACTATCACAGAAGAGG + Intergenic
1200048150 X:153413455-153413477 TCCGAGGCCCCTCACAGAGGTGG + Intergenic
1200404337 Y:2794652-2794674 CTCAGGGACCATCTCAGAAGAGG - Intergenic
1201518147 Y:14840759-14840781 TCTAAGGACCCTCACAAAACAGG + Exonic