ID: 986713957

View in Genome Browser
Species Human (GRCh38)
Location 5:10509141-10509163
Sequence ATGTGGTTATGGTGGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 1, 2: 2, 3: 60, 4: 437}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986713957_986713964 23 Left 986713957 5:10509141-10509163 CCTTCTTCCCACCATAACCACAT 0: 1
1: 1
2: 2
3: 60
4: 437
Right 986713964 5:10509187-10509209 TCTAACAGACTCTCCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986713957 Original CRISPR ATGTGGTTATGGTGGGAAGA AGG (reversed) Exonic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
901071848 1:6524300-6524322 ATGTGATCATGCTGGGAAGATGG + Exonic
901830766 1:11890912-11890934 ATAGGGTGATGGTGGGGAGAGGG - Intergenic
905628428 1:39504361-39504383 ATAGGGTAATGGTGGGGAGAGGG + Intronic
905628490 1:39504820-39504842 ATAGGGTAATGGTGGGGAGAGGG + Intronic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906751486 1:48266643-48266665 AAGTGTTTATGTTGGGAAAATGG - Intergenic
906825880 1:48979550-48979572 ATTTGGATAGGGTGGGAAAAAGG + Intronic
908673987 1:66580372-66580394 ATGTAGTTATCAGGGGAAGAGGG - Intronic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910130700 1:83902058-83902080 ATGGGAATGTGGTGGGAAGATGG - Intronic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912950397 1:114116712-114116734 ATGTGGTCTTGCTGGGAAGCTGG - Intronic
913338344 1:117732115-117732137 ATGAGGAGATGCTGGGAAGAAGG + Intergenic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915703764 1:157823828-157823850 AAGTGGCCATGGTGGAAAGATGG - Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915891060 1:159774356-159774378 ATGGGATTTGGGTGGGAAGAAGG + Intergenic
915903942 1:159864660-159864682 CTGTGGTTAGGGTTGGAACATGG + Intronic
916657006 1:166885199-166885221 TTGTGGTTATTGTGGCAAAATGG - Intergenic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918824490 1:189305625-189305647 ATGTTTTTATGGTGTGAAAAAGG - Intergenic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
920273177 1:204782548-204782570 ATGTGGCTATGGCTGGATGAAGG - Intergenic
921108794 1:212012245-212012267 ATGTGGTTATGGTAGGAGATTGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922058120 1:222061381-222061403 ATGTGGTTCTTGTTGGAAGTGGG + Intergenic
922398514 1:225226825-225226847 ATAGGGTCATGGTGGGGAGAGGG + Intronic
922681963 1:227606254-227606276 ATAGGGTGATGGTGGGGAGAAGG + Intronic
922976733 1:229791146-229791168 TGGTGCCTATGGTGGGAAGAAGG - Intergenic
923127730 1:231047188-231047210 AAGGGGTTATGGAGGGAAGGAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064438141 10:15329090-15329112 ATGTGGTGATGTCGGGAAGAAGG + Intronic
1065777181 10:29131881-29131903 ATGTTGGGATGGTGGGATGAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066761679 10:38760441-38760463 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1066959908 10:42211980-42212002 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1067472027 10:46544426-46544448 AGGGGGTTGAGGTGGGAAGATGG - Intergenic
1067574130 10:47397074-47397096 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1068308921 10:55254302-55254324 ATGTGGTTATGGTTATAAAATGG + Intronic
1069689859 10:70343334-70343356 ATGTGGTTTTGGGGGGGAAAAGG + Intronic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1071388596 10:85147085-85147107 TTGTGTTTTTGGTGGGAAGTTGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072386936 10:94940325-94940347 ATTTAGTAATGGTAGGAAGAAGG + Intronic
1073466298 10:103696388-103696410 AAGTGGTCATGGTGTGAAGGGGG - Intronic
1073859196 10:107717887-107717909 ATGTGGTTCTGGTTTGAAGATGG - Intergenic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074747415 10:116548633-116548655 AGGAGGTGGTGGTGGGAAGAGGG + Intronic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1075549524 10:123381938-123381960 ATGTAGTTGTGGTGGGTAGTAGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076297087 10:129394594-129394616 AGGTGGCAATTGTGGGAAGAGGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077176095 11:1191471-1191493 TTGTGCTTGTGGTGGGAACAGGG - Intronic
1077601523 11:3578054-3578076 ATGTGTTTATGGTGGGGAGGCGG - Intergenic
1077899348 11:6476944-6476966 ACATTGCTATGGTGGGAAGAGGG - Exonic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078329269 11:10405968-10405990 ATCTGGTAAGGGTGGGAAGGGGG + Intronic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1078590952 11:12640817-12640839 ATGTGGTGATGGGGGGATGGTGG - Intergenic
1079488697 11:20963263-20963285 ATGTGGTTATGGTGGTAATAGGG - Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1079720153 11:23800916-23800938 AAGTGGTTAGGGTTGGAAGGGGG + Intergenic
1081147272 11:39578430-39578452 ATTTGGTCACAGTGGGAAGAAGG - Intergenic
1083040615 11:59681888-59681910 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1083141041 11:60722231-60722253 ATTTGGACATTGTGGGAAGAGGG - Intergenic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083467753 11:62860061-62860083 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1083875704 11:65523526-65523548 ACAGGGTGATGGTGGGAAGAAGG - Intergenic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084257430 11:67952623-67952645 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1084815340 11:71642631-71642653 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1085340514 11:75728196-75728218 ATTTTATTTTGGTGGGAAGATGG + Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085583582 11:77678712-77678734 ATGGGGTTACAGTGAGAAGATGG + Intronic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1086128908 11:83380380-83380402 ATGAGGTTACAGTGAGAAGATGG + Intergenic
1087312984 11:96571848-96571870 ATATGGTTATGATGATAAGACGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088884121 11:113993896-113993918 ATGAGGCTGTGGTGGGGAGACGG + Intergenic
1089514997 11:119026696-119026718 AGGGAGTTGTGGTGGGAAGAGGG + Intronic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1089727461 11:120495120-120495142 AGGAGGTTGAGGTGGGAAGATGG - Intergenic
1090011178 11:123047221-123047243 CTGTGGTTTTAGTGGGAAGCAGG - Intergenic
1090092533 11:123711080-123711102 AGGAGGTTAAGGTGGGAGGATGG + Intergenic
1090373274 11:126271545-126271567 ATGTGGTGATCGTGGGAGGTGGG + Exonic
1090453458 11:126826984-126827006 CTGGGATTATGGTGGGCAGAGGG + Intronic
1091002380 11:131921131-131921153 ATTTTTTTATGGTGGGGAGATGG - Intronic
1091539582 12:1447409-1447431 AGGTAGTTAAGGTGGGAGGATGG + Intronic
1091665157 12:2413670-2413692 ATGAGGTTATGGAGGGACGGCGG - Intronic
1091726826 12:2852334-2852356 AGGTGGTTAAGGTGGTTAGAGGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092427667 12:8387407-8387429 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098883509 12:75940682-75940704 ATGCTGTTTTGCTGGGAAGACGG + Intergenic
1099504393 12:83454792-83454814 ATGGGGATATGATGAGAAGATGG + Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100721548 12:97364416-97364438 ATGGTTTTATAGTGGGAAGATGG + Intergenic
1100909621 12:99343957-99343979 ATGTGGTGATTCTGGGAACATGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1104511328 12:129381865-129381887 AAGTGGTTATGCTGGGCAGCAGG - Intronic
1104809101 12:131609897-131609919 GTGGGGTTTTGGTGGGAAGGCGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106842404 13:33698263-33698285 TAGGGGTTAGGGTGGGAAGAGGG - Intergenic
1106868492 13:33993620-33993642 ATATGGTGATGGTGGGAGGTAGG + Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1110612700 13:77506669-77506691 ATGTTATGAGGGTGGGAAGAGGG - Intergenic
1111017969 13:82405741-82405763 TTGTGCTTATAGTAGGAAGAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112264055 13:97906295-97906317 ATGTGGTAAACGTGGGAAGGAGG + Intergenic
1112641901 13:101284933-101284955 ATGTGTGTATGGTAGGAATAGGG + Intronic
1112703362 13:102037525-102037547 ATGTGATTATGTTAGGAATATGG - Intronic
1113126535 13:106985333-106985355 AGGGGGTGGTGGTGGGAAGAAGG - Intergenic
1113717882 13:112526569-112526591 ATGTGGTGATGGTGTGATTATGG - Intronic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1114275524 14:21140314-21140336 ATGTGGTTTTGGTGCAAGGATGG - Intergenic
1114926831 14:27412581-27412603 AAGTGGTGAAGGTGGGGAGAAGG + Intergenic
1116688502 14:48074106-48074128 ATTTGGTTATATTGGGATGAGGG + Intergenic
1117076089 14:52106171-52106193 ATTGGGTTTTGGTAGGAAGAGGG - Intergenic
1117154134 14:52920837-52920859 AGGTGGCTGAGGTGGGAAGATGG + Intronic
1118324679 14:64772976-64772998 ATGTGGTTATGGGGGGCACAGGG + Intronic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1120684962 14:87527716-87527738 ATGAGGTTATAATGAGAAGATGG - Intergenic
1124600178 15:31127488-31127510 ATGTGGTGAAAGTGGGAAGGTGG + Intronic
1124682158 15:31741266-31741288 AGGAGGTTGTGGTGGGAACAAGG + Intronic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1127440822 15:59005697-59005719 ATGTGGTGATCGTGGGTAGGGGG + Intronic
1127611407 15:60641055-60641077 AGGAGGTTAAGGTGGGAGGATGG - Intronic
1128346995 15:66860591-66860613 ATGTGATTATGGTGTGAATGTGG + Intergenic
1128845390 15:70890297-70890319 AGGTGGTGATGGTGGACAGATGG + Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1130108493 15:80946541-80946563 ATGTGGTGATGGAGGAAGGAAGG - Intronic
1130117345 15:81016568-81016590 ATGGGGTCATCCTGGGAAGAGGG + Intronic
1131284151 15:91043675-91043697 ATGTGGTTAGAGTGGGAATGAGG + Intergenic
1132436772 15:101812306-101812328 AGGTGGTTGTGGTGGGGAAATGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133370577 16:5242962-5242984 ATGTGATTATGGTGGGGACGTGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1137012225 16:35333282-35333304 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137016583 16:35382067-35382089 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137018958 16:35403720-35403742 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137042875 16:35629559-35629581 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137609262 16:49808164-49808186 AGGAGGCTATGGTGGGAGGATGG - Intronic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1137881187 16:52050208-52050230 ATGTGTTTAGGGTGGGTAGGGGG + Intronic
1139953466 16:70682651-70682673 ATGTGGTTACCGTGGGGAGGGGG - Intronic
1141938281 16:87256321-87256343 ATGAGGTTATGGCAGGAGGATGG + Intronic
1143459087 17:7089063-7089085 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1143469004 17:7159811-7159833 ATAGGGTGATGGTGGGGAGAGGG - Intergenic
1143618371 17:8067061-8067083 AAGTGGCTATGCTGGGAAGTTGG + Intergenic
1145792670 17:27637709-27637731 ATATGGTGGTGGTGGGGAGAGGG + Intronic
1145807543 17:27745577-27745599 ATATGGTGGTGGTGGGGAGAGGG + Intergenic
1146166626 17:30594668-30594690 ATAGGGTAATGGTGGGTAGAGGG + Intergenic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1147745940 17:42694658-42694680 CCATGGTGATGGTGGGAAGATGG - Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149604874 17:57917387-57917409 ATGTGGTCATCCTGGGACGAAGG + Intronic
1150857442 17:68766652-68766674 ATGTGGTTGTGTTGGGAGGTGGG - Intergenic
1151959280 17:77396982-77397004 ATGTGGTTGTGGTGGGATTGGGG + Intronic
1152962905 18:90438-90460 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155542375 18:26881922-26881944 ATGTAGTTCAGGTGGGGAGAGGG - Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156438510 18:37159575-37159597 ATATGCTAATGGTGGGAACACGG + Intronic
1157058326 18:44256498-44256520 ATATGGGTATGGTCAGAAGAAGG + Intergenic
1157475251 18:48019872-48019894 ATGTGGTGATGGGGGAGAGATGG + Intergenic
1157777140 18:50404415-50404437 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1157792871 18:50548575-50548597 ATGTTGTTTTGGTAGGAAAAGGG + Intergenic
1157827605 18:50826414-50826436 ATGGAGTTGTGGTGGGAAGCTGG - Intergenic
1157874190 18:51256640-51256662 ATGTGGTGGTGGGGGGAGGAGGG + Intergenic
1157949958 18:52025013-52025035 ATGGGGCTAAGGTGGGAGGAAGG + Intergenic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1160006988 18:75075104-75075126 ATGTGGTGATAGTGGGCAGCTGG - Intergenic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1161752768 19:6109989-6110011 AGGGGGTTAAGGTGAGAAGAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163919739 19:20277326-20277348 ATAGGGTAATGGTGGGAAGAGGG - Intergenic
1163920757 19:20286460-20286482 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1164229824 19:23277254-23277276 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164723449 19:30449595-30449617 AAGTGTTGATGGTGGGAAGGGGG + Intronic
1165328833 19:35130101-35130123 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1165485634 19:36093858-36093880 ATGTGTTTCTAGTGGGGAGACGG + Intronic
1165652301 19:37501964-37501986 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1165894893 19:39135790-39135812 ATGGGGTCACTGTGGGAAGATGG - Intronic
1166596331 19:44053334-44053356 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1166659866 19:44639795-44639817 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1166706923 19:44913164-44913186 ATGTAGTGATGGTGGGAAGCAGG + Intergenic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167336877 19:48891829-48891851 ATAGGGTGATGGTGGGGAGAGGG + Intronic
1167814670 19:51869448-51869470 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167819087 19:51909734-51909756 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167820315 19:51921890-51921912 ATAGGGTAATGGTGGGAAGAGGG - Intronic
1167820747 19:51925638-51925660 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167824335 19:51958530-51958552 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1167824555 19:51960467-51960489 ATAGGGTGATGGTGGGGAGAGGG + Intergenic
1167827078 19:51983699-51983721 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167951072 19:53028114-53028136 ATAAGGTAATGGTGGGGAGAGGG + Intergenic
1168151557 19:54451538-54451560 ATTTGGTTGTGGTGTGGAGAGGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925346410 2:3175063-3175085 ATGTGGTGATGTGGGGAAGGAGG - Intergenic
928419781 2:31129445-31129467 ATGTCCTTATGGTGGGCAGGTGG - Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929395609 2:41518766-41518788 ATGTGGTTCTCCTGGGAAGGAGG + Intergenic
929945538 2:46369012-46369034 ATCTGGTTTTGATGGGAAGTGGG - Intronic
930858862 2:56049046-56049068 ATGTGCTTGTGGTGGGGAGGTGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
932117802 2:69068911-69068933 ATGTGATGATGGTGAGAGGAAGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933275625 2:80280789-80280811 ATGTGGATATGCTGGGCAAAAGG - Intronic
933286185 2:80386984-80387006 ATGTGTTTATGGTAGGATGAGGG + Intronic
934324990 2:92005108-92005130 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
940688461 2:156884042-156884064 ATGTGGTGATTGTGGTAGGAAGG - Intergenic
940691936 2:156929273-156929295 ATGTTGCTAAGGTGGGAATAAGG - Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
942313502 2:174678221-174678243 ATTTAGTTATGCTGGAAAGATGG + Intronic
942593572 2:177571151-177571173 ATGTTGTTATGCTGGGTAGTAGG + Intergenic
946267265 2:218556965-218556987 ATAAGGTTGAGGTGGGAAGATGG - Intronic
946870119 2:224077267-224077289 ATGCTGTTCTGGTGGGATGATGG - Intergenic
946912833 2:224484064-224484086 ATGAGGCTAAGGTGGGAGGATGG + Intronic
947212695 2:227722436-227722458 ATGGGGTAATGGTGGGGAGAGGG + Intergenic
947408114 2:229802509-229802531 ATTTTGTAATGGTGGGGAGAAGG - Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948467843 2:238160612-238160634 AGGGTGTTGTGGTGGGAAGATGG - Intronic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
1168761609 20:353675-353697 AGGGGGTTATGGTGAGAAGGGGG - Exonic
1169109603 20:3023650-3023672 ATAGGGTAATGGTGGGCAGAGGG - Intronic
1169706657 20:8513920-8513942 AGGAGGCTAAGGTGGGAAGATGG + Intronic
1169810884 20:9608046-9608068 GTGAGGTTATAGTGAGAAGATGG - Intronic
1170848664 20:19983819-19983841 ATGAGGTTAGGGTGGGAGGGAGG - Intronic
1170996212 20:21362109-21362131 ATGTGGTTCTGAGGGGAAGTAGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172341218 20:34159346-34159368 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1173064088 20:39692864-39692886 ATGTGATCATTTTGGGAAGATGG + Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1174031907 20:47635560-47635582 TTGTTGTTCTGGTAGGAAGATGG - Exonic
1174468970 20:50741406-50741428 ATGTGGTAAAGGTGGGAAGGTGG - Intronic
1175326199 20:58130009-58130031 ATGTGGTCATGGAGGCAACAGGG - Intergenic
1175626959 20:60496845-60496867 ATTTGGTTATCTTGGGAAGTGGG - Intergenic
1176222812 20:63978173-63978195 ATGCAGTTACTGTGGGAAGAGGG - Intronic
1180043097 21:45290346-45290368 ATGTGGTTAGAGTGGGAGGGGGG + Intergenic
1180584495 22:16874893-16874915 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181332743 22:22106854-22106876 TTGTGGTTTTGGTGACAAGAGGG - Intergenic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181400900 22:22649572-22649594 ATATGGTAATAGTGGGGAGAGGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181702879 22:24630670-24630692 ATATGGTAATAGTGGGGAGAGGG + Intergenic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1182605738 22:31501894-31501916 ATGTGCTTATCGTGGGGACATGG - Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1183628424 22:39018657-39018679 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183631027 22:39032566-39032588 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183634536 22:39052965-39052987 ATTAGGTTATGCTGGGGAGATGG - Exonic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
951378670 3:21955725-21955747 ATTGAGTTATGGTGGTAAGAGGG + Intronic
952093771 3:29923444-29923466 ATGTGTTGTTGGTGGGCAGATGG + Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955302701 3:57797564-57797586 ATGTGGTTATTCTTGGAAGCTGG + Intronic
955910967 3:63859938-63859960 ATGTGGTTTAGGTGGGTAGTGGG - Intronic
957072368 3:75577110-75577132 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
957792733 3:84960114-84960136 ATATGATGATGGTGGGAAGAGGG - Intronic
959194555 3:103163023-103163045 ATGTGATAATGTTGGGAAGTGGG - Intergenic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
962538097 3:136349751-136349773 ATGTTGTTTTGCTGGAAAGAGGG - Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
963235350 3:142950572-142950594 ATGAGCTTAAGGTGGGAAAAAGG + Intronic
964850537 3:161091511-161091533 GTGTGGATACGCTGGGAAGAGGG - Intronic
964908785 3:161752003-161752025 TTTGGGTTATGGTGGGAATATGG - Intergenic
965993020 3:174844187-174844209 TTTTGTATATGGTGGGAAGAAGG + Intronic
966595408 3:181720634-181720656 ATGTGGTTATGTTCTGGAGACGG - Intergenic
966772999 3:183520577-183520599 ATAGGGTAATGGTGGGGAGAGGG + Intronic
967551857 3:190805093-190805115 CACTGCTTATGGTGGGAAGAAGG + Intergenic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
969737990 4:9003929-9003951 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
969797186 4:9535483-9535505 ATGTGTTTATGGTGGGGATGTGG + Intergenic
970089719 4:12391108-12391130 ATGTTTTTTTGGTGGGAAAAGGG + Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970971727 4:21991876-21991898 ATGTGGTGGTGGTGGGAGTAGGG - Intergenic
972155358 4:36154506-36154528 ATATGGTTGAGGTGGGAAAAGGG + Intronic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972607849 4:40630362-40630384 ACTTGTTTATGGGGGGAAGAAGG - Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
974512647 4:62864925-62864947 ATTTTGTTATTGTAGGAAGAAGG - Intergenic
974960550 4:68694187-68694209 ATAGGGTTATAGTGGGGAGAGGG - Intergenic
976025505 4:80683141-80683163 ATGTGGTGATGGTGGTGGGAAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976609784 4:87018499-87018521 AAGTGGTGATGGTGGTGAGAAGG + Intronic
978927599 4:114267916-114267938 ATATTTTTATTGTGGGAAGAGGG + Intergenic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979425631 4:120561834-120561856 ATGTGGTTACACTGGTAAGAAGG - Intergenic
979509618 4:121537523-121537545 ATGTGGTTGTGTTTGGAATAAGG + Intergenic
979516114 4:121612300-121612322 ATGTGATTAGGGTTGGAAGAAGG - Intergenic
980614918 4:135207122-135207144 ATTTTGATATGGTGAGAAGAAGG + Intergenic
981936120 4:150241771-150241793 ATGTGGTTAGAGTGAGGAGATGG - Intronic
982231328 4:153210917-153210939 ATGTGTTGAGTGTGGGAAGAGGG - Intronic
982271112 4:153589454-153589476 ATGTGGATATGCTGGGCAGAGGG + Intronic
982660627 4:158202068-158202090 CTGTGGTTGAGGTGGAAAGAAGG - Intronic
983465666 4:168085680-168085702 ATGTGGTTGTGGTGAAAGGAAGG + Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
985160999 4:187044559-187044581 ACATGGTTATGGTGTCAAGAGGG - Intergenic
985631664 5:1017258-1017280 AGGCGGTGATGGTGGGCAGAGGG - Intronic
986495566 5:8338485-8338507 AGGTGGTGGTGGTGGGAGGAGGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989309661 5:39999863-39999885 ATGTGGAGATGCTGGGAAGGTGG + Intergenic
990008292 5:50967249-50967271 ATGTGTTTATGGCGGACAGATGG + Intergenic
991042349 5:62189062-62189084 ATGTAGTTATGGTGTGAGGAAGG - Intergenic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992729509 5:79647073-79647095 ATATGGTTCTGTTGGGAAGCAGG - Intronic
993050895 5:82924520-82924542 AGGTGGTGATGGTGGGAGGGAGG + Intergenic
994153376 5:96474989-96475011 GTGTTGTTTTGGTGAGAAGAAGG + Intergenic
994356899 5:98803006-98803028 ATGTGGTTAAAGTGAGAAGGGGG - Intergenic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996920078 5:128757798-128757820 ATGGGATTATGGTGGCAAGATGG - Intronic
997228802 5:132228304-132228326 TTGTGGTGGTGCTGGGAAGAAGG - Intronic
997230341 5:132238101-132238123 AGGTGGTGAAGGTGGAAAGATGG + Intronic
997963391 5:138338739-138338761 ATATGGTTCTGGTGGGGAAAGGG - Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998161376 5:139814630-139814652 ATGTGGTTATGGGGCCACGATGG + Intronic
998266106 5:140668995-140669017 AGCTGGTTATGGTGGGATGGAGG + Intronic
998535885 5:142930349-142930371 ATGGGCTGATGGTGGGAAGTGGG + Intronic
999019030 5:148142733-148142755 AAGTGGTTGTGCTAGGAAGAGGG + Intergenic
999019215 5:148144605-148144627 GAGTGGTTATGTTAGGAAGAGGG - Intergenic
999295894 5:150459188-150459210 ATGTGGTTGTGATGTGACGACGG + Intergenic
999989245 5:157034226-157034248 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000409985 5:160928064-160928086 ATGAGGTGAGGGTGGGGAGAGGG + Intergenic
1000834648 5:166138825-166138847 AGGAGGTCAAGGTGGGAAGATGG - Intergenic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002257498 5:177968933-177968955 ATGTGGTGGTGGTGGGAGGTGGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1003213119 6:4085665-4085687 AGGTGTTTTTGGTGGGGAGAAGG - Intronic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1005445678 6:25920061-25920083 ACTTGGTTTTGGTGGGAAGAAGG + Intronic
1005525351 6:26642232-26642254 ATAAGGTAATGGTGGGGAGAGGG - Intronic
1005730042 6:28688105-28688127 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1006216255 6:32445385-32445407 ATGGGGTTAGAGTGGGGAGAAGG + Intergenic
1006289292 6:33122162-33122184 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1008061587 6:47003135-47003157 TTGAGGTTATGATGGGAAGTGGG + Intronic
1008797809 6:55325974-55325996 ATTTCCTTCTGGTGGGAAGATGG - Intergenic
1009629389 6:66173965-66173987 ATGTGGTTAGATTGGCAAGAAGG + Intergenic
1010333827 6:74657360-74657382 ATGTGGAGATGGTGGTAGGAAGG + Intergenic
1010577767 6:77553811-77553833 AAGTGGTTTTGGTAGGATGAAGG + Intergenic
1011388296 6:86821576-86821598 ATGTGCTGATGGTGAGAAAATGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1013225512 6:108117600-108117622 ATGTGCGTGTGGTGCGAAGAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014186404 6:118439336-118439358 AGGAGGTTAAGGTGGGAGGATGG - Intergenic
1014860847 6:126466521-126466543 ATGTGGTAATGGTATAAAGATGG + Intergenic
1014915092 6:127136935-127136957 ATGAGCTTATTGTGGGGAGAAGG + Intronic
1015285265 6:131479398-131479420 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1015503114 6:133953413-133953435 AGGGGGTTACCGTGGGAAGAGGG - Exonic
1016532460 6:145074042-145074064 ATGTAGTTAATGTGGGAAAAGGG - Intergenic
1016632149 6:146245616-146245638 ATATGTTTGTGGTGGGAAAATGG - Intronic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1018752716 6:166821571-166821593 AGGTGGTTACGGTGGGAGGAGGG - Intronic
1019289978 7:245656-245678 ATGTGGTCATGGTGGAAACGTGG - Intronic
1019591918 7:1839886-1839908 AGGTGGTTATGGGGGGAGGCGGG - Intronic
1021378748 7:19940587-19940609 ATGTGGTTCAGATGGGCAGAGGG + Intergenic
1021847085 7:24773874-24773896 ATGTGGTTATGCTGGGAACTAGG - Intergenic
1022292158 7:29015262-29015284 ATGTGGTGATGGTGGCAAGGCGG - Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022677548 7:32513832-32513854 ATAGGGTGATGGTGGGGAGAGGG + Intronic
1023137115 7:37063892-37063914 AAGTGGTTGTGGTGGCAGGAGGG - Intronic
1023219689 7:37906956-37906978 ATGTGTTTATGGTCTGCAGAAGG - Exonic
1025650315 7:63461068-63461090 AAGTGTTTATGGTGGCCAGATGG + Intergenic
1025828131 7:65027043-65027065 ATGTTGTTATGGTGGGAGTGGGG + Intergenic
1025996630 7:66531477-66531499 AAGTGGATTTGGTGGGTAGAGGG - Intergenic
1026988683 7:74570880-74570902 AAGTGGATTTGGTGGGTAGAGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027870163 7:83696462-83696484 AGCTGGTCATGGTAGGAAGAAGG - Intergenic
1028120290 7:87049849-87049871 ATGTGGTGATGTTGGGAGGTGGG + Intronic
1028199278 7:87941768-87941790 ATGAGGTTATGGTGCACAGAAGG + Intronic
1028220503 7:88190819-88190841 AAGTGATTATTTTGGGAAGATGG - Intronic
1029577273 7:101411795-101411817 GTGTGGTTCTGGTGGAAAGGAGG + Intronic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1031779141 7:125940445-125940467 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1032260190 7:130329595-130329617 ATGTGGTTGTGTTTGGAAGCTGG - Intergenic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1035059865 7:156061605-156061627 ATGGGGTTGGGGTGGGAAGTGGG - Intergenic
1036257719 8:7218837-7218859 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036258969 8:7225834-7225856 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036307652 8:7613677-7613699 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036309768 8:7677433-7677455 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036311022 8:7684430-7684452 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036358506 8:8061678-8061700 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036359768 8:8068686-8068708 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036829647 8:12011952-12011974 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1036891192 8:12598284-12598306 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036892452 8:12605274-12605296 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036899997 8:12663252-12663274 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1039385774 8:37134347-37134369 ATTTGGTTCTGGTGGGAGGGTGG - Intergenic
1041853909 8:62426907-62426929 ATGTGGATAAGGTGGAAACATGG + Intronic
1041944020 8:63421873-63421895 AAGTGGTAATGGTGGTGAGAGGG - Intergenic
1042069823 8:64919580-64919602 ATGTGGTTCCGGGGGCAAGAAGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044046742 8:87444859-87444881 ATATGGTGATGGTAGGAAGTGGG + Intronic
1044085209 8:87935402-87935424 ATGAGGTTAAAGTGAGAAGATGG - Intergenic
1047196987 8:122730554-122730576 TTGTCCTTATGGTGGCAAGATGG - Intergenic
1048287370 8:133152237-133152259 ATTTTTTTCTGGTGGGAAGAGGG - Intergenic
1048372798 8:133794227-133794249 AATTGGTGATGGTGTGAAGATGG + Intergenic
1048618927 8:136110035-136110057 ATGTGATAATGGTTGGAAAAGGG + Intergenic
1048834889 8:138509822-138509844 ATGAGGTTACAGTGAGAAGATGG - Intergenic
1049054628 8:140226105-140226127 ATGTGGTTCTGGTGGGATCAAGG + Intronic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1050073843 9:1843579-1843601 ATATGGTTTTGGGGGGAACATGG - Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052205499 9:25834822-25834844 ATGTGGTAATGGTGGGGGTAAGG - Intergenic
1052760097 9:32581468-32581490 ATGTGGTAGTGGTGGGGAGTGGG - Intergenic
1053693436 9:40612462-40612484 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1053940424 9:43242856-43242878 ATGAGGCTGAGGTGGGAAGACGG - Intergenic
1054271394 9:63027623-63027645 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1054304679 9:63411690-63411712 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054403426 9:64735711-64735733 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054437048 9:65221199-65221221 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054493350 9:65800793-65800815 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1056335544 9:85564971-85564993 ATGAGGTTACAGTGAGAAGAAGG + Intronic
1056567270 9:87785167-87785189 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1056969478 9:91190646-91190668 ATGTGCTTTTGGTCTGAAGAAGG + Intergenic
1057085255 9:92204083-92204105 ATGTGGACATAGTGAGAAGATGG + Intergenic
1057538889 9:95945796-95945818 ATATAGTTGTGTTGGGAAGATGG + Intronic
1057958069 9:99427552-99427574 ATGTGATTATGTTAGGAAGATGG + Intergenic
1059479802 9:114580305-114580327 AGGAAGTTAAGGTGGGAAGATGG + Intergenic
1060210604 9:121707901-121707923 ATGTGGTGAAGTTGGAAAGAGGG - Intronic
1061076512 9:128344707-128344729 CTGTGGTCATGGTGGGTCGAGGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062486706 9:136780537-136780559 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1062487770 9:136789017-136789039 ATAGGGTAATGGTGGGGAGAAGG + Intergenic
1062735238 9:138133690-138133712 ATAGGGTAATGGTGGGCAGAGGG - Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1187340894 X:18420526-18420548 AGGTGATGATGGTGGGAAGTGGG + Intergenic
1187434610 X:19255915-19255937 ATGTGGTTATTGTGTAAAAAGGG - Intergenic
1187906589 X:24072386-24072408 AGGAGGTTAAGGTGGGAGGATGG - Intronic
1188139028 X:26525691-26525713 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1188384029 X:29533901-29533923 TTCTGGTGATGGTGGGAAGTGGG + Intronic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1190748218 X:53339246-53339268 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1190798894 X:53770454-53770476 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1191227971 X:58065548-58065570 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192859310 X:75048720-75048742 ATGTTGTTTTGCTGGGGAGAGGG + Intergenic
1193964842 X:87972796-87972818 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1195100601 X:101551304-101551326 GTGTGGTTTTGCTGGGAAAATGG + Intronic
1195198333 X:102520706-102520728 ATGGGGTAATGGTAGGTAGAAGG - Intergenic
1195460028 X:105114209-105114231 GTGAGGTTACAGTGGGAAGATGG + Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1196194141 X:112822512-112822534 ATTGGGTTGTGGTGGGGAGAGGG + Exonic
1196755191 X:119151251-119151273 ATGCTGTTGTGGCGGGAAGATGG - Intergenic
1198316449 X:135471525-135471547 ATATGTTCATGGTGGGAAGAAGG - Intergenic
1198720931 X:139619326-139619348 ATGTTGTTATGATGGGAGGAAGG + Intronic