ID: 986714082

View in Genome Browser
Species Human (GRCh38)
Location 5:10510102-10510124
Sequence GTATAGCCGTAGCCATAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 19}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986714082_986714084 -7 Left 986714082 5:10510102-10510124 CCACTCTATGGCTACGGCTATAC 0: 1
1: 0
2: 1
3: 4
4: 19
Right 986714084 5:10510118-10510140 GCTATACGAGGAGCAGAAATAGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986714082 Original CRISPR GTATAGCCGTAGCCATAGAG TGG (reversed) Intronic
903368199 1:22817837-22817859 GCATAGCCATAGCCAAAGATGGG + Intronic
1077559810 11:3252698-3252720 GTTTAGCAGTAGCCACAGGGAGG + Intergenic
1077565703 11:3298501-3298523 GTTTAGCAGTAGCCACAGGGAGG + Intergenic
1089621056 11:119722488-119722510 GGCTAGCCGTGGCCATAGAGAGG - Intronic
1095837894 12:46658256-46658278 GTATAGGAGTAGCCACAGATTGG - Intergenic
1116434055 14:44877241-44877263 GTACAGGCGCAGCCATAGTGGGG + Intergenic
1131719240 15:95149098-95149120 GTATAGCCTTAGCCTTAGAGAGG - Intergenic
1166799345 19:45446558-45446580 GAATAGCCGTCCCAATAGAGGGG - Intronic
932485213 2:72080571-72080593 GAATAGCTGTAGCCATGGTGGGG - Intergenic
934721419 2:96579689-96579711 GGAGAGCTGTAGCCATGGAGAGG - Intergenic
935678209 2:105614286-105614308 TTATAGCCGTAGAGATAGAATGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
971299608 4:25430901-25430923 GTAGAGCAGTAGCCTTAGAGCGG - Intergenic
986714082 5:10510102-10510124 GTATAGCCGTAGCCATAGAGTGG - Intronic
997591278 5:135074087-135074109 TTATAGCCAAAGCCAGAGAGGGG + Intronic
999100349 5:149018779-149018801 GAATAGCAGTAGCCATGGAGAGG - Intronic
1000819141 5:165961416-165961438 CTATAGCCATAGCCATAGATGGG - Intergenic
1012188933 6:96257099-96257121 GTATAGCAGTGGCATTAGAGAGG - Intergenic
1019830893 7:3329049-3329071 GTCTAGCAGTAGCAAGAGAGGGG - Intronic
1038520253 8:28226158-28226180 GAATAGCCAGAGTCATAGAGTGG - Intergenic
1039369596 8:36971403-36971425 GTATAGCAGTAACCCTAGATAGG + Intergenic
1044998738 8:97861615-97861637 GAAAAGCAGTAACCATAGAGCGG - Intergenic
1046103383 8:109640213-109640235 TTATAGCCTTAGCCAGAGACAGG + Intronic
1186541918 X:10409702-10409724 GTATATTCACAGCCATAGAGTGG + Intergenic
1197070122 X:122286502-122286524 GTATAGACATAACCAAAGAGTGG - Intergenic