ID: 986718468

View in Genome Browser
Species Human (GRCh38)
Location 5:10540910-10540932
Sequence AACCTACTTGGGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718468_986718476 19 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718476 5:10540952-10540974 AGGGTCCAGATGAGAACCCTAGG No data
986718468_986718473 -7 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718473 5:10540926-10540948 GTAGGTTTTTAAAATGCAGATGG No data
986718468_986718475 0 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718468_986718477 20 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718468_986718474 -1 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718474 5:10540932-10540954 TTTTAAAATGCAGATGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718468 Original CRISPR AACCTACTTGGGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr