ID: 986718470

View in Genome Browser
Species Human (GRCh38)
Location 5:10540920-10540942
Sequence GCATTTTAAAAACCTACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718470_986718477 10 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718470_986718481 27 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718481 5:10540970-10540992 CTAGGGCCTGTCCACTGCTCTGG No data
986718470_986718475 -10 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718470_986718476 9 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718476 5:10540952-10540974 AGGGTCCAGATGAGAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718470 Original CRISPR GCATTTTAAAAACCTACTTG GGG (reversed) Intergenic
No off target data available for this crispr