ID: 986718475

View in Genome Browser
Species Human (GRCh38)
Location 5:10540933-10540955
Sequence TTTAAAATGCAGATGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718466_986718475 3 Left 986718466 5:10540907-10540929 CCACCACACCTGGCCCCAAGTAG No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718464_986718475 30 Left 986718464 5:10540880-10540902 CCAAAGTGCTAGAATTACAGATG 0: 34
1: 1229
2: 16909
3: 107983
4: 239040
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718468_986718475 0 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718470_986718475 -10 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data
986718469_986718475 -5 Left 986718469 5:10540915-10540937 CCTGGCCCCAAGTAGGTTTTTAA No data
Right 986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718475 Original CRISPR TTTAAAATGCAGATGGTACA GGG Intergenic
No off target data available for this crispr