ID: 986718477

View in Genome Browser
Species Human (GRCh38)
Location 5:10540953-10540975
Sequence GGGTCCAGATGAGAACCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718468_986718477 20 Left 986718468 5:10540910-10540932 CCACACCTGGCCCCAAGTAGGTT No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718470_986718477 10 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718472_986718477 8 Left 986718472 5:10540922-10540944 CCAAGTAGGTTTTTAAAATGCAG No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718469_986718477 15 Left 986718469 5:10540915-10540937 CCTGGCCCCAAGTAGGTTTTTAA No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718466_986718477 23 Left 986718466 5:10540907-10540929 CCACCACACCTGGCCCCAAGTAG No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data
986718471_986718477 9 Left 986718471 5:10540921-10540943 CCCAAGTAGGTTTTTAAAATGCA No data
Right 986718477 5:10540953-10540975 GGGTCCAGATGAGAACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718477 Original CRISPR GGGTCCAGATGAGAACCCTA GGG Intergenic
No off target data available for this crispr