ID: 986718481

View in Genome Browser
Species Human (GRCh38)
Location 5:10540970-10540992
Sequence CTAGGGCCTGTCCACTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718471_986718481 26 Left 986718471 5:10540921-10540943 CCCAAGTAGGTTTTTAAAATGCA No data
Right 986718481 5:10540970-10540992 CTAGGGCCTGTCCACTGCTCTGG No data
986718470_986718481 27 Left 986718470 5:10540920-10540942 CCCCAAGTAGGTTTTTAAAATGC No data
Right 986718481 5:10540970-10540992 CTAGGGCCTGTCCACTGCTCTGG No data
986718472_986718481 25 Left 986718472 5:10540922-10540944 CCAAGTAGGTTTTTAAAATGCAG No data
Right 986718481 5:10540970-10540992 CTAGGGCCTGTCCACTGCTCTGG No data
986718478_986718481 -10 Left 986718478 5:10540957-10540979 CCAGATGAGAACCCTAGGGCCTG No data
Right 986718481 5:10540970-10540992 CTAGGGCCTGTCCACTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718481 Original CRISPR CTAGGGCCTGTCCACTGCTC TGG Intergenic
No off target data available for this crispr