ID: 986718769

View in Genome Browser
Species Human (GRCh38)
Location 5:10543824-10543846
Sequence TTGTAGACACAGTTTTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986718767_986718769 -7 Left 986718767 5:10543808-10543830 CCTTTTTCTGTTCCTTTTGTAGA No data
Right 986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG No data
986718765_986718769 2 Left 986718765 5:10543799-10543821 CCCGTCTGTCCTTTTTCTGTTCC No data
Right 986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG No data
986718766_986718769 1 Left 986718766 5:10543800-10543822 CCGTCTGTCCTTTTTCTGTTCCT No data
Right 986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986718769 Original CRISPR TTGTAGACACAGTTTTATCT AGG Intergenic
No off target data available for this crispr