ID: 986719044

View in Genome Browser
Species Human (GRCh38)
Location 5:10546994-10547016
Sequence CTTCCATAAATGAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986719044_986719047 16 Left 986719044 5:10546994-10547016 CCTTGTTCCTTCATTTATGGAAG No data
Right 986719047 5:10547033-10547055 ATTCATTTGTATATCTGTAAGGG No data
986719044_986719046 15 Left 986719044 5:10546994-10547016 CCTTGTTCCTTCATTTATGGAAG No data
Right 986719046 5:10547032-10547054 CATTCATTTGTATATCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986719044 Original CRISPR CTTCCATAAATGAAGGAACA AGG (reversed) Intergenic
No off target data available for this crispr