ID: 986723580

View in Genome Browser
Species Human (GRCh38)
Location 5:10577857-10577879
Sequence GACCCCACGGTGCAGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986723580_986723592 30 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723592 5:10577910-10577932 TTTGGAGGGTCCAGGTCTTAGGG 0: 1
1: 0
2: 1
3: 9
4: 103
986723580_986723587 16 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723587 5:10577896-10577918 GCTGACCTCCATGCTTTGGAGGG No data
986723580_986723586 15 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723586 5:10577895-10577917 TGCTGACCTCCATGCTTTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 156
986723580_986723589 22 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723589 5:10577902-10577924 CTCCATGCTTTGGAGGGTCCAGG 0: 1
1: 0
2: 3
3: 18
4: 175
986723580_986723584 12 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723584 5:10577892-10577914 CCCTGCTGACCTCCATGCTTTGG 0: 1
1: 0
2: 1
3: 24
4: 229
986723580_986723591 29 Left 986723580 5:10577857-10577879 CCAGCTTGCTGCACCGTGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 986723591 5:10577909-10577931 CTTTGGAGGGTCCAGGTCTTAGG 0: 1
1: 0
2: 2
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986723580 Original CRISPR GACCCCACGGTGCAGCAAGC TGG (reversed) Intronic
901394587 1:8971767-8971789 GACCCCAGCGTGCTGGAAGCAGG + Intronic
905656674 1:39690429-39690451 GTCCCCACGGAGCAGCAGGAAGG + Intronic
916336874 1:163682093-163682115 CAGCCCACAGTTCAGCAAGCAGG - Intergenic
924724736 1:246658924-246658946 GACTCCAAGGTGCAGGAAGAAGG - Intronic
1067211183 10:44261370-44261392 GACCCCAGGCTGCAGTGAGCAGG + Intergenic
1067343857 10:45424238-45424260 GCCCCCATGCTGCAGCAGGCAGG - Intronic
1072300218 10:94053657-94053679 GACCTCACTCTGGAGCAAGCTGG - Intronic
1073460110 10:103661301-103661323 GACCCCGCGGTGCAGCGGGCCGG - Intronic
1076405852 10:130212207-130212229 GACCCCAGGGTGCAAGTAGCGGG + Intergenic
1077332819 11:1990809-1990831 GGCCCCACGTTGCAGAAAACTGG - Intergenic
1078437003 11:11333709-11333731 GCCACCACGGTGCAGCAGCCAGG + Intronic
1078889275 11:15539575-15539597 GAGCCAAAGGGGCAGCAAGCGGG + Intergenic
1083775608 11:64893132-64893154 GACACCACGCTGCAGGAGGCTGG - Intergenic
1084727475 11:70951210-70951232 GACGTCACGGTGCAGCAGCCAGG - Intronic
1084727480 11:70951247-70951269 GACATCACGGTGCAGCAGCCAGG - Intronic
1084972705 11:72780528-72780550 CAACCCAGGGTGCAGAAAGCGGG + Intronic
1090106105 11:123854868-123854890 GCCCCCACGGTGCAGCACAATGG + Intergenic
1090351795 11:126112667-126112689 GACCCCAGGGCCCAGCAAACAGG + Intergenic
1202815802 11_KI270721v1_random:45985-46007 GGCCCCACGTTGCAGAAAACTGG - Intergenic
1096116986 12:49060491-49060513 GACCCCCCGGTGCCGGGAGCCGG - Intergenic
1099190997 12:79561823-79561845 GAGCCCACGGTGGGGAAAGCAGG - Intergenic
1103894662 12:124265040-124265062 GCACCCAGGGTGCAGCATGCAGG - Intronic
1104789686 12:131473676-131473698 GACCCCAAGGGGCAGCGAGCTGG + Intergenic
1108526120 13:51287467-51287489 GGCCGCACTGTGCAGCAAGGTGG + Intergenic
1116900299 14:50356104-50356126 GACCCCACCTGGCACCAAGCAGG + Intronic
1119802451 14:77457974-77457996 GAACCCACGGTGCGGCGAGTTGG + Intronic
1121652397 14:95568788-95568810 GAGGCCACGGTGCAGAAAGTTGG - Intergenic
1123706064 15:22951776-22951798 GACCCCATGGTGGAGGAAGGTGG + Intronic
1124142197 15:27087309-27087331 GACCCCGAGGTGAAGCATGCAGG - Intronic
1124237838 15:28005065-28005087 GACACCACGGTCCAGCTCGCAGG - Intronic
1126559163 15:50024697-50024719 GCCCCCAGGTTGCAGCAAGTTGG - Intronic
1129199986 15:73992955-73992977 GAACCCACAGCCCAGCAAGCAGG + Intronic
1129522382 15:76194043-76194065 GTCCCCACGATGCAGCCAGTAGG + Intronic
1129894231 15:79091648-79091670 GCCCTCCCGGTGCAGCATGCGGG - Intergenic
1130077492 15:80701932-80701954 AACCACACGGTGAGGCAAGCCGG - Intronic
1131811714 15:96180173-96180195 CACCCCACGGTGGTGCAAGCTGG + Intergenic
1132313739 15:100876306-100876328 CACCCCACTGTGCAGCACTCAGG - Intergenic
1132686810 16:1165660-1165682 GACCCCAGCGTGCAGCCACCTGG - Intronic
1137774276 16:51042456-51042478 TACCCCACAGTGCACCAGGCTGG - Intergenic
1139485776 16:67255820-67255842 GACCACACGCTTCACCAAGCGGG + Exonic
1140904225 16:79396688-79396710 GACTCCAGTGTGCAGCAAGTTGG - Intergenic
1145889686 17:28405879-28405901 GACCCCACCATGCAGGTAGCGGG - Exonic
1145964324 17:28906249-28906271 GACCCCATCCTGCAGCAGGCTGG + Exonic
1148719368 17:49739831-49739853 TACCCCACGGTGCTGTAAACAGG - Intronic
1152317124 17:79587631-79587653 CCCCCCACGGAGCAGCAGGCTGG + Intergenic
1152896132 17:82912472-82912494 GACCCCAAGGTCCAGGGAGCTGG + Intronic
1152922451 17:83072847-83072869 GCCCGCACGTTGCAGCAGGCAGG + Intergenic
1155585086 18:27355446-27355468 GACAACACGGTGCAGCAGGTGGG + Intergenic
1159770445 18:72542009-72542031 GCCCGCACGGGGCAGCAGGCGGG + Exonic
1161465662 19:4428938-4428960 GACCCCAGGGTTCAGGATGCTGG - Intronic
1161737722 19:6001898-6001920 GACCACACTGTCCAGCCAGCTGG + Exonic
1161777974 19:6274148-6274170 GTCCCCTGGGTGCAGCAGGCCGG - Intronic
1162464111 19:10830405-10830427 GACCCCAGGGTGCAGGCAGTTGG - Intronic
1164557219 19:29263035-29263057 GAGCCCACGGTTCTGCAATCCGG + Intergenic
1165050602 19:33139193-33139215 CACCCCAAGGTGCAGCAGGCAGG + Intronic
1165530958 19:36400958-36400980 GACCCCAGGTTCCAGCAAGATGG - Intronic
1166448870 19:42880933-42880955 GCCCCCAGGGTGCAGCGGGCAGG + Intronic
1168187957 19:54713207-54713229 GTCCCCAAGATGCAGCAAGGAGG + Intergenic
925223022 2:2158163-2158185 GACCACACAGTGTAGCAAGTGGG + Intronic
925309336 2:2871201-2871223 GACCCCACCCTTCACCAAGCAGG - Intergenic
927460514 2:23294451-23294473 GCCACCAGGGTGCAGCAAGTGGG - Intergenic
936275315 2:111091055-111091077 GACCCCATAGTGAGGCAAGCAGG - Intronic
938705443 2:133920591-133920613 CACCCCAAGCTGCAGTAAGCAGG + Intergenic
946149304 2:217753410-217753432 GACCCCAGGTGGCAGCACGCGGG + Intronic
947466034 2:230347440-230347462 GAGCCCAGCTTGCAGCAAGCTGG - Intronic
948156557 2:235788200-235788222 GACCCTACGGTACAGCCAGCCGG + Intronic
948320473 2:237064674-237064696 GGCTCCACCGAGCAGCAAGCAGG - Intergenic
948783370 2:240338513-240338535 GACCCCACACAGCAGCAGGCCGG - Intergenic
1173143715 20:40506768-40506790 GACCCCAGAATGCAGCAAACTGG - Intergenic
1174080747 20:47969246-47969268 GCCCCAACGGTGAAGGAAGCGGG - Intergenic
1178549088 21:33520001-33520023 GACCCCACGGTACAGGCAGATGG - Intronic
1178588818 21:33892322-33892344 CACCCCACGGTGCAAAAAGAAGG - Exonic
1181311424 22:21946860-21946882 GACCCCACTGTGCGGCATGTGGG + Intronic
1184362496 22:44026720-44026742 AAGCCGACGGTGCAGCAGGCAGG - Intronic
1185066274 22:48633136-48633158 GCCCCCACTGGGCAGCAAGGAGG + Intronic
949143646 3:667586-667608 GACCCCACTATTCAGCCAGCTGG - Intergenic
954534474 3:51348866-51348888 GATCCCACTGTGCAGGGAGCTGG + Exonic
957524869 3:81367190-81367212 GACCCCACGTTACAGCAAATGGG - Intergenic
957974807 3:87429751-87429773 GAGTCCATGGGGCAGCAAGCAGG - Intergenic
960429126 3:117547320-117547342 GACCCAAAGGGGCAGCAACCAGG - Intergenic
961161459 3:124730338-124730360 AACCCACGGGTGCAGCAAGCCGG + Intergenic
961279268 3:125752949-125752971 GCCTCCATGGTGCACCAAGCAGG + Intergenic
961809778 3:129515085-129515107 GAACCCAAGGTGCAGAAAGATGG - Intronic
966931579 3:184678942-184678964 GGTCACACGGTCCAGCAAGCTGG - Intronic
985475252 5:75279-75301 GACCCCCCAGTGCAGCAGGATGG - Intergenic
986723580 5:10577857-10577879 GACCCCACGGTGCAGCAAGCTGG - Intronic
989712838 5:44421700-44421722 GATTCCACGACGCAGCAAGCAGG + Intergenic
992090419 5:73311706-73311728 GAGCCCTCGCTGCAGCACGCAGG + Intergenic
997365064 5:133320326-133320348 GACCCCACAGTGAAACCAGCAGG - Intronic
999275273 5:150325764-150325786 GACCCCACCATGCATCAAGAGGG - Intronic
999833295 5:155341457-155341479 GAGCCCACAGTGCAGCAGGAAGG + Intergenic
1002566405 5:180114649-180114671 GACCCCAGGGTGCAGAGGGCAGG + Intronic
1006361545 6:33589855-33589877 GACCCCACAGGGAAGCCAGCAGG - Intergenic
1006796829 6:36737420-36737442 GGCCCCACAGAGCAGCAAGAGGG - Intergenic
1007475692 6:42118455-42118477 GAGCCCAGGGTGCTGCCAGCAGG + Intronic
1018931369 6:168242332-168242354 GCCCCCACAGTGCAGCACCCAGG + Intergenic
1021899187 7:25266241-25266263 GACCCCCGGCTGCAGCAGGCTGG - Intergenic
1023746296 7:43325838-43325860 GACCACAGCGTGCAGCAATCTGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1032836843 7:135682664-135682686 GACCCCATGGAGCATCCAGCTGG + Intronic
1033707823 7:143905741-143905763 GAACCCACAGTGCAGGAAGAAGG + Intergenic
1036832096 8:12028707-12028729 GCCTCCATGGTGCACCAAGCAGG - Intergenic
1039453510 8:37694105-37694127 GATCCCACATTGCAGCAAGAGGG - Intergenic
1039506249 8:38054593-38054615 GACCCCAGGGTCCAGGCAGCGGG - Intronic
1045345194 8:101287699-101287721 CTCCCCACAGTGCAGCAAGTAGG - Intergenic
1047578017 8:126179717-126179739 GAAACCAGAGTGCAGCAAGCCGG + Intergenic
1048266247 8:132989835-132989857 GACATCACGGTGCAGCACGTGGG + Intronic
1049310069 8:141929131-141929153 GACCTCACCGTGCACCAACCTGG + Intergenic
1053000474 9:34574786-34574808 GTCCCCACGGTGCAAGAGGCTGG - Intronic
1053577268 9:39365187-39365209 GACTCCATGGGGCAGCAAGAGGG - Intergenic
1053841768 9:42193112-42193134 GACTCCATGGGGCAGCAAGAGGG - Intergenic
1054098839 9:60923877-60923899 GACTCCATGGGGCAGCAAGAGGG - Intergenic
1054120239 9:61199506-61199528 GACTCCATGGGGCAGCAAGAGGG - Intergenic
1054587515 9:66983056-66983078 GACTCCATGGGGCAGCAAGAGGG + Intergenic
1060722625 9:125989079-125989101 CACCCCATGGTGCAGCGAGGGGG - Intergenic
1061395640 9:130342152-130342174 GGCCCCATGGTGCAGCCACCAGG - Intronic
1062713038 9:137987052-137987074 GCCCCTACGGTGAAGGAAGCTGG + Intronic
1185608245 X:1379563-1379585 GTCCCCAGGGTGGAGGAAGCAGG + Intronic
1187048879 X:15676120-15676142 GAAACCAAGGAGCAGCAAGCTGG + Intergenic
1192795990 X:74424072-74424094 GACCTCACAGTGCAGCTAGAGGG + Intronic
1193365170 X:80623204-80623226 CTCCCCACAGTGCAGCAAACTGG - Intergenic
1195219976 X:102737632-102737654 GTCCCCAGGGTGTGGCAAGCAGG - Intronic
1200115505 X:153768123-153768145 GACCCCAAGGCCCAGCAATCAGG - Intronic