ID: 986726439

View in Genome Browser
Species Human (GRCh38)
Location 5:10601561-10601583
Sequence CAGGACATTCAGTCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986726439_986726450 30 Left 986726439 5:10601561-10601583 CCTTCCCCAGACTGAATGTCCTG 0: 1
1: 0
2: 1
3: 23
4: 356
Right 986726450 5:10601614-10601636 GTATTTTGAACACACAGCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 168
986726439_986726449 29 Left 986726439 5:10601561-10601583 CCTTCCCCAGACTGAATGTCCTG 0: 1
1: 0
2: 1
3: 23
4: 356
Right 986726449 5:10601613-10601635 TGTATTTTGAACACACAGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986726439 Original CRISPR CAGGACATTCAGTCTGGGGA AGG (reversed) Intronic
900395960 1:2453359-2453381 GAGGACATTGAAGCTGGGGATGG + Intronic
902151987 1:14450718-14450740 CCGGACATCAAGTGTGGGGAAGG + Intergenic
903442061 1:23395533-23395555 AGGGACATTCAGGCTGGGGGTGG + Intronic
904391816 1:30191005-30191027 AAGGCCATTCTGTCTGGAGATGG - Intergenic
906639872 1:47435255-47435277 GAGGACATTCAGGCCGGGCAGGG + Intergenic
906878422 1:49563302-49563324 CAGGACAATCAGGCAGGAGAAGG - Intronic
907526651 1:55057648-55057670 AAGGACACTCAGTCTGATGAGGG + Intronic
907643887 1:56221246-56221268 TTGGGTATTCAGTCTGGGGAAGG + Intergenic
908895525 1:68894195-68894217 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
909036246 1:70597112-70597134 CAGGACAATTAGTCAGGAGAAGG - Intergenic
909055398 1:70815031-70815053 CAGGACAATTAGTCAGGAGAAGG - Intergenic
909065095 1:70926674-70926696 CAGGACAATTAGTCAGGAGAAGG - Intronic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
910285527 1:85550201-85550223 CAGGTCATTAGGTCTTGGGAGGG - Intronic
911676534 1:100664970-100664992 CAGGACAATCAGGCAGGAGAAGG - Intergenic
912122699 1:106492250-106492272 CAGCAGCTTCAGTCTGGGCAAGG + Intergenic
913123659 1:115765486-115765508 CAGGTGTTTCAGCCTGGGGATGG + Intronic
913231633 1:116744966-116744988 CAGGGCATTCAGACTGGGAATGG - Intergenic
913422024 1:118680652-118680674 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
913585741 1:120273667-120273689 CAGGCCTTGCAGTCTGGTGAAGG + Intergenic
913622444 1:120624702-120624724 CAGGCCTTGCAGTCTGGTGAAGG - Intergenic
914216432 1:145634369-145634391 CAGGACAATAAGGCTGGGCATGG - Intronic
914456083 1:147837684-147837706 AAGGACATTGAGTCTGGGGCTGG - Intergenic
914469003 1:147957027-147957049 CAGGACAATAAGGCTGGGCATGG - Intronic
914567747 1:148885526-148885548 CAGGCCTTGCAGTCTGGTGAAGG + Intronic
914605076 1:149244719-149244741 CAGGCCTTGCAGTCTGGTGAAGG - Intergenic
918070546 1:181130838-181130860 CAGGACATTGACTCTTGGAAGGG + Intergenic
919935900 1:202250692-202250714 AAGGACATCCAGTCTGGGTGTGG - Intronic
919987963 1:202689051-202689073 CAGGAGATTCAGTCTGGGGGCGG - Intronic
920481827 1:206329799-206329821 CAGGACAATCAGGCAGGAGAAGG - Intronic
921285405 1:213604830-213604852 CAGGACTGTGGGTCTGGGGAAGG + Intergenic
922128480 1:222753543-222753565 TAGGACATTCAGTCTTTGTATGG + Intergenic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
924419231 1:243891914-243891936 CAGTCCATTTAGCCTGGGGAGGG - Intergenic
1063289646 10:4732377-4732399 CAAGACATTCATACTGGGCAAGG - Intergenic
1066032258 10:31440554-31440576 CAGGACAATCAGGCAGGAGAAGG + Intronic
1067498720 10:46783044-46783066 TCAGACATTCAGTATGGGGAAGG + Intergenic
1070011403 10:72478397-72478419 CAGAACATTTAGTATGGGAAGGG - Intronic
1076129766 10:128005671-128005693 AAGGACCCTCAGTCTGGTGATGG + Intronic
1076228790 10:128802826-128802848 CAGGACATTCATCCTGGAGAAGG + Intergenic
1078115684 11:8447784-8447806 CAGGACAATCAGGCAGGAGAAGG + Intronic
1078141919 11:8699225-8699247 CAGCTCCTTCAGTTTGGGGAGGG + Exonic
1080059596 11:27943209-27943231 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1080378738 11:31744887-31744909 CAGGGCACTCAGGCAGGGGAAGG + Intronic
1080434100 11:32223996-32224018 CAGGACAATCAGGATGGTGAGGG - Intergenic
1080877767 11:36292289-36292311 CTGTACAATCAGTCTGGTGATGG + Intergenic
1081257476 11:40914695-40914717 CAGGACAATCAGTCAGGAGAAGG + Intronic
1081537123 11:44004271-44004293 CACGAGCTTGAGTCTGGGGAAGG + Intergenic
1082298308 11:50472398-50472420 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1082567304 11:54696303-54696325 CAGGACAATCAGACAGGAGAAGG - Intergenic
1082630184 11:55532753-55532775 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1082667330 11:55990016-55990038 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1082956264 11:58873279-58873301 CAGGGCATTCAGGCAGGAGAAGG - Intronic
1083383678 11:62290823-62290845 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
1085005385 11:73083721-73083743 TAGGACATTCAGTCAGAAGAAGG - Exonic
1086736124 11:90307390-90307412 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1086921735 11:92595302-92595324 GAGGACACACAGGCTGGGGAGGG - Intronic
1089179713 11:116574268-116574290 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1091404008 12:197743-197765 GAAGACATTTAGTCTGGGAAAGG + Intronic
1091485714 12:885691-885713 CAGGACAATGAGTATGGGGCTGG - Exonic
1092041496 12:5389156-5389178 CAGCACATTCAGTTGGAGGAAGG - Intergenic
1094437271 12:30434497-30434519 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1094592935 12:31838196-31838218 CAGCAGATTCTGTCTGGTGAGGG + Intergenic
1094853494 12:34392751-34392773 CTGGACATGCACGCTGGGGAGGG - Intergenic
1096582758 12:52598958-52598980 CTGGAGATGCTGTCTGGGGACGG - Exonic
1098795137 12:74878887-74878909 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1099737432 12:86587942-86587964 CAGGGCAATCAGTCAGGAGAAGG - Intronic
1100112658 12:91264488-91264510 CATGAGATTCAGACTGGTGAAGG + Intergenic
1100679157 12:96899953-96899975 CAGGACATCCAGTCTCAGAAAGG - Intergenic
1100834785 12:98556028-98556050 AAAGACATTCAGGCTGGGCACGG + Intergenic
1101051788 12:100871539-100871561 CAGGGCATTCAGTCTACAGAAGG - Intronic
1101197777 12:102403374-102403396 CAGGACTTTTAGTCTTGGCATGG - Intronic
1103529744 12:121592676-121592698 CAGGGCTTACAGTCTGGTGAAGG - Intergenic
1103897936 12:124286304-124286326 GGGGACATCCAGTCTGGGGTGGG - Intronic
1104927131 12:132319656-132319678 CAGGCCTTTCCGTCTGGGGCAGG + Intronic
1106429442 13:29665954-29665976 CAGGAAGTTCAGACTGGGTAGGG + Intergenic
1106833461 13:33610240-33610262 AAGGAGGTTCACTCTGGGGAGGG + Intergenic
1106923782 13:34591771-34591793 TTGGACATTCAGGCTGGGCATGG - Intergenic
1107358414 13:39593119-39593141 CAGGACAATCAGGCAGGAGAAGG + Intronic
1109101077 13:58184134-58184156 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1110415071 13:75243145-75243167 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1110797885 13:79660999-79661021 TAGGACTTACAGTCTGGCGAGGG - Intergenic
1111515646 13:89327466-89327488 GATGTCATTCAATCTGGGGAGGG - Intergenic
1112722282 13:102258562-102258584 CCATACCTTCAGTCTGGGGACGG + Intronic
1112926958 13:104687981-104688003 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1113442066 13:110336866-110336888 CACCACATTCAGCCTGGGGCTGG + Intronic
1114993182 14:28314506-28314528 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1115159545 14:30378070-30378092 CAGGAAATGGATTCTGGGGAGGG - Intergenic
1115342570 14:32308022-32308044 CAGGACATTCACTCATGGCAGGG + Intergenic
1116078299 14:40141558-40141580 CAGGACAGTCAGGCAGGAGAAGG - Intergenic
1118721165 14:68594836-68594858 TGGGACATTTGGTCTGGGGAGGG - Exonic
1120222515 14:81750291-81750313 CATGGCTTTCACTCTGGGGAAGG + Intergenic
1120878714 14:89397999-89398021 CAGGATAGTCAGACTGGGGCTGG - Intronic
1121316554 14:92964392-92964414 CAGGAAAGTCAGGGTGGGGAGGG + Intronic
1121459283 14:94061606-94061628 CAGGGAATTCACTCTGGGAAGGG - Intronic
1122422326 14:101585297-101585319 CACCACATTCAGTGTGGAGAAGG + Intergenic
1122624826 14:103079212-103079234 CAAGCCATTGAGTCTGGGGCAGG - Intergenic
1122763982 14:104052145-104052167 GAGGAAAGTCAGTCTGCGGAGGG - Exonic
1122966526 14:105130460-105130482 CAGTAGATTCAGGCTGGGCATGG - Intergenic
1125641621 15:41235843-41235865 CAGAACCTTCAGGCTGGTGAGGG - Intronic
1128129390 15:65215454-65215476 AAGGACATTCACACTGGTGAGGG - Intergenic
1129012189 15:72430351-72430373 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1129573213 15:76712932-76712954 CAGGGCAGTCAGACTGGAGAAGG - Intronic
1130802253 15:87277310-87277332 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1130915696 15:88302817-88302839 CAGGGGATGCAGTTTGGGGATGG + Intergenic
1131283942 15:91042357-91042379 CAGGACCTTCAGGAAGGGGAGGG - Intergenic
1132004770 15:98217227-98217249 CAGGACATTCACACTGGGAGAGG + Intergenic
1132375985 15:101328506-101328528 TAGAACATTCTGTCTGGAGATGG - Intronic
1133810467 16:9157460-9157482 CAGAACTGTCAGTCTGGGGCTGG + Intergenic
1135258818 16:20963579-20963601 CAGGCCATGCAGTTTGGGTAAGG + Exonic
1135793826 16:25422853-25422875 CAGGAATTTTAGTCTGGGCATGG + Intergenic
1135994213 16:27236096-27236118 CAGGTCCATCAGTCTGAGGAGGG + Intronic
1136899795 16:34022803-34022825 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1137004107 16:35256081-35256103 CAGGAGATTCAGGACGGGGAGGG - Intergenic
1137019997 16:35415133-35415155 CAGAAAATTCAGGATGGGGAAGG - Intergenic
1141431881 16:83974491-83974513 CAGGGAATTCGGTCTGGGGGAGG + Intronic
1143655806 17:8292932-8292954 CTGGAGATCCAGTCTGGGAATGG - Intronic
1144500876 17:15786280-15786302 CAGGTCTGTCCGTCTGGGGACGG + Intergenic
1145392850 17:22469486-22469508 CAGGAATTGCAGTCTGGAGAGGG - Intergenic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146023748 17:29301589-29301611 GAGCACATTCAGGCTGGGCACGG + Intergenic
1146550265 17:33774801-33774823 AAAGATATTCAGTCTAGGGATGG - Intronic
1147282963 17:39377791-39377813 CAGGACTTGCAGGCTGGGCACGG - Intronic
1147578730 17:41617027-41617049 CAGGACATCCTGCCAGGGGAAGG - Intergenic
1148911197 17:50944139-50944161 CAGGAGTCTCAGGCTGGGGAGGG - Intergenic
1149385740 17:56141772-56141794 CAGAACAATCAGTGTGGGGGTGG + Intronic
1149389503 17:56174804-56174826 ACTGACATTCAGTCTGGGGGAGG - Intronic
1149775879 17:59356750-59356772 CACCAGATTCAGTCTGGTGAGGG + Intronic
1151403398 17:73871045-73871067 CAGGGCATTGGGTCTGGGGGTGG - Intergenic
1151884550 17:76915941-76915963 CAGGAAATTCAGACTTGGGTAGG + Intronic
1152360655 17:79831783-79831805 AAGGACATTCATTCCGTGGAGGG + Intergenic
1152913164 17:83016962-83016984 CAGGACATTTAGCCTGGGCTTGG - Intronic
1153015521 18:579625-579647 CTTGACATTCAATGTGGGGAAGG - Intergenic
1153483004 18:5566112-5566134 CAGGACAATCAGGCAGGAGAAGG + Intronic
1153706559 18:7751293-7751315 CAGCACAGTGAGTCAGGGGAGGG - Intronic
1153857738 18:9167711-9167733 CAGGACAATCAGGCAGGAGAAGG - Intronic
1154139744 18:11812551-11812573 AATGACATTCAGGCTGGGCACGG + Intronic
1155701521 18:28749919-28749941 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1156114596 18:33772791-33772813 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1158293011 18:55963021-55963043 CAAGAAATTCAGTCTTGTGAGGG + Intergenic
1159280325 18:66276608-66276630 GAGGACATTTATTCTGGGAATGG + Intergenic
1159961962 18:74562292-74562314 AAGGACAGTAAGTCTTGGGAAGG + Intronic
1161953100 19:7478446-7478468 CCGGACATACAGTCTGGGACAGG + Intronic
1163697095 19:18769469-18769491 GAGGACATTTAGCCTGGGGCTGG - Intronic
1164511559 19:28901292-28901314 AAGGAGATTCAGGCTGGGCACGG + Intergenic
1166101081 19:40571762-40571784 CAGGAAATTCAGTATGGGAGGGG + Intronic
1166795037 19:45420731-45420753 CAGGACACGCAGACTGGGGCTGG - Intronic
1167831930 19:52030589-52030611 TATGACATACAGTCTGGTGAAGG - Intergenic
1167949813 19:53016976-53016998 CAGGAGACTCCATCTGGGGAGGG + Intergenic
925707553 2:6701504-6701526 AAGGGCATTCACCCTGGGGAAGG + Intergenic
925989619 2:9243892-9243914 CAGCACATTTATTCTGGGGAGGG - Intronic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
927295023 2:21444167-21444189 CATGAAATTCAGTCTGGTGTAGG - Intergenic
928195821 2:29215824-29215846 CAGGCCATGTAGTCTGGGGCTGG + Intronic
931279852 2:60780601-60780623 CAGAACATTCACTCTGTAGAAGG + Intronic
931391842 2:61851199-61851221 CAGAATTTTCAGTCTGGTGAGGG - Intronic
931400867 2:61930144-61930166 CAGGACAGTCAGTCTTTGGTTGG + Intronic
931707695 2:64961011-64961033 GAGGACACTCAGTCTGTGGTGGG + Intergenic
931888535 2:66644611-66644633 CAGGACAATCAGGCAGGAGAAGG - Intergenic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
932963431 2:76442686-76442708 CAGGACAATCAGGCAGGAGAAGG - Intergenic
934766861 2:96884555-96884577 CAAGAGCCTCAGTCTGGGGAGGG + Intronic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
937144847 2:119635797-119635819 CTGGTCATTCAGTCTGGAGGAGG + Intronic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
937863938 2:126733714-126733736 CAGGACAGGCATTCTGGGGCAGG + Intergenic
940004008 2:148995016-148995038 GAGCAGATTCAGTGTGGGGATGG - Intronic
940384602 2:153055998-153056020 GCAGACATTAAGTCTGGGGAAGG + Intergenic
940698146 2:157006293-157006315 CATGACATTCAGTAAGGGTAAGG - Intergenic
941342916 2:164329502-164329524 CAGGTCTTTCAGTCTCTGGAAGG - Intergenic
943140849 2:183979563-183979585 CAGGACAATCAGGCAGGAGAAGG + Intergenic
945749352 2:213761569-213761591 AGGGACATTCAGGCTGGGCACGG + Intronic
946384424 2:219373909-219373931 CGGGACACCCATTCTGGGGATGG + Exonic
947615596 2:231554991-231555013 CAGGACTTACTGTCTGTGGATGG - Intergenic
948192416 2:236070161-236070183 GAGGAAACTGAGTCTGGGGAGGG - Intronic
948259797 2:236595152-236595174 CAGGCCAATCACTCTGGTGATGG - Intergenic
948271345 2:236675722-236675744 CAGGACATTCATTCTGTGTCAGG - Intergenic
1169096875 20:2908600-2908622 CATGACATTCAGGCTGGGTGTGG + Intronic
1169906221 20:10607504-10607526 CAGGGCAGTCAGCCTTGGGAGGG - Intronic
1170687471 20:18582276-18582298 CAGGACATTGTGTCTGGGTGGGG + Intronic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171306883 20:24114261-24114283 CAGGCCTTTCAGACTGGAGAAGG - Intergenic
1172636093 20:36410925-36410947 CAGGAAGTACAGTGTGGGGATGG - Intronic
1173086178 20:39920750-39920772 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1174238372 20:49112782-49112804 AAGAACCTTCAGTCTGGGGGAGG + Intergenic
1176881640 21:14201833-14201855 CAGGGCAATCAGGCTGGAGAAGG + Intronic
1176938356 21:14893598-14893620 TAGGAAATGAAGTCTGGGGAAGG - Intergenic
1177285336 21:19041647-19041669 CAGGACATCCATTCTGGCTAGGG + Intergenic
1179048235 21:37866157-37866179 GAAGACATTCTGTCTGTGGATGG + Intronic
1179301326 21:40113559-40113581 CAGGGCATTCAGGCAGGAGAAGG + Intronic
1180232873 21:46437808-46437830 AAGGACGTTCAGCCTGTGGAGGG - Intronic
1180999735 22:19982419-19982441 CAGGCCATGCAGCTTGGGGAGGG - Intronic
1182254974 22:29031490-29031512 CAGGACATTCTCGCTGGGCAAGG - Intronic
1183377898 22:37475714-37475736 GAGGGCATGCAGGCTGGGGAGGG - Intronic
1183898816 22:40990280-40990302 CAGGACCTTCAGGGTGGGGGTGG + Intergenic
1184172608 22:42768798-42768820 CAGGTCACTCAGACTGTGGAGGG - Intergenic
1184766682 22:46576142-46576164 CAGGGGACCCAGTCTGGGGAGGG + Intronic
1185267417 22:49911722-49911744 TAAGACATTCAGACTGGGCATGG - Intronic
949921005 3:9000429-9000451 CAGGACTCTGAGACTGGGGATGG - Intronic
950004306 3:9681871-9681893 CAGGAACTACAGGCTGGGGAGGG - Intronic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
952515317 3:34098209-34098231 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
954586080 3:51737934-51737956 GAGGGCATTCAGGCTGGGGATGG - Intergenic
954796924 3:53166187-53166209 CAGGGCCTTCACTCTGGGGTAGG + Intronic
955135836 3:56217137-56217159 CAGGGCAATCAGTCAGGAGAAGG + Intronic
956173376 3:66450770-66450792 CAGGAAATTCAGTGTGAAGAGGG + Intronic
956279245 3:67539052-67539074 CAGGACAATCAGGCAAGGGAAGG - Intronic
957631470 3:82721469-82721491 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
960754034 3:120989955-120989977 CAGGACAATCAGGCAGGAGAAGG + Intronic
960966550 3:123109043-123109065 CAGGACATTGTGTCTGGGGGAGG - Intronic
961332828 3:126153176-126153198 CAGGGCACTCAGCCTGGAGATGG + Intronic
961682443 3:128608211-128608233 CAGGAAACTCAGCCTCGGGAAGG - Intergenic
961918465 3:130401511-130401533 CAGGGCATCCAGTATGTGGATGG - Intronic
962072972 3:132050847-132050869 CAGGACAATCAGGCAGGAGAAGG - Intronic
962894534 3:139702185-139702207 TAGGACATCCAGGCTGGGTAAGG + Intergenic
964464076 3:156970269-156970291 CAGGGCAATCAGGCTGGAGAAGG + Intronic
965369068 3:167838470-167838492 AAGGACATTTAGTCTGGGCAGGG - Intergenic
965654264 3:170967318-170967340 CAGTACATTGAGGCTGGGAATGG + Intergenic
968606899 4:1539840-1539862 GAGGACCTGCAGTCTGGGGAGGG - Intergenic
968708016 4:2092404-2092426 CAGGGCCGTCAGGCTGGGGACGG + Intronic
969090097 4:4687402-4687424 CAGGAGCTTCAGTCTGGGAAAGG - Intergenic
969354712 4:6618656-6618678 CAGGTCATGCCTTCTGGGGAGGG - Intronic
969645934 4:8428749-8428771 CAGGACCCCCAGTCTGGGGCCGG + Intronic
971239400 4:24874166-24874188 CAGAACAATCAGTGTTGGGAGGG + Intronic
973098643 4:46233375-46233397 CAGGACAATCAGGCAGGAGAAGG - Intergenic
973124921 4:46571255-46571277 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
973329571 4:48898771-48898793 CAGGAAATTTAGTCTGGGAAAGG + Intronic
974286272 4:59871649-59871671 CAGGACATTCTGGCAGGGCAAGG - Intergenic
975088853 4:70376642-70376664 CAGGACAATCAGGCAGGAGAAGG + Intronic
975290378 4:72671205-72671227 CAGGACACTGAGACTTGGGATGG + Intergenic
975505619 4:75133586-75133608 CAGGACAGTCAGTTAGGAGATGG - Intergenic
975818892 4:78249143-78249165 CAGAACACTCACTCTGGGGAAGG + Intronic
976682544 4:87773218-87773240 CAGGACAATCAGACAGGAGAAGG + Intergenic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977711370 4:100129719-100129741 CAGGACAACCAAGCTGGGGAAGG - Intergenic
977982778 4:103345015-103345037 CAGGACATTTATCATGGGGAAGG - Intergenic
979042488 4:115815807-115815829 CAGGACAGTCAGGCAGGAGAAGG + Intergenic
979267434 4:118719728-118719750 CAGCTCTTCCAGTCTGGGGATGG + Intergenic
979423549 4:120536153-120536175 CATGACCTTCAGTTTGGTGATGG - Intergenic
979772263 4:124542249-124542271 AAGGACGTTCAGTCTGGAAATGG + Intergenic
980418945 4:132533948-132533970 CTTGACATTCAGCCTGGGGATGG - Intergenic
981109780 4:140922116-140922138 CAGGGCATTCAGGCAGGAGAAGG + Intronic
981208316 4:142070484-142070506 CAGGACAATCAGGCAGGAGAAGG + Intronic
981418735 4:144524347-144524369 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
981447150 4:144853032-144853054 CAGGCCACTCTGTCTTGGGAAGG + Intergenic
982067995 4:151671604-151671626 GAGGACACTGAGTCTGGGGAGGG + Intronic
983174040 4:164567240-164567262 CAGGACAATCAGGCAGGAGAAGG + Intergenic
983492213 4:168400884-168400906 TATGACATTCAGTGTGGGGATGG + Exonic
985771292 5:1813172-1813194 CAGGATTTTCAGTGTGGGGAAGG - Intronic
986216227 5:5721586-5721608 CTGGACATGCAGTCTTGGGCAGG + Intergenic
986555293 5:9004467-9004489 CAGGACAATCAGGCAGGAGAAGG - Intergenic
986726439 5:10601561-10601583 CAGGACATTCAGTCTGGGGAAGG - Intronic
987826706 5:23039124-23039146 AAGGACATACATTCTGGAGAGGG + Intergenic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
991148450 5:63335926-63335948 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
991539201 5:67707808-67707830 CAGGACAATCAGGCAGGAGAAGG + Intergenic
992029133 5:72703043-72703065 CATGACCTTCAGCCTGGGGGCGG - Intergenic
992357064 5:75996978-75997000 CAGGACAGTCAGGCAGGAGAAGG - Intergenic
993188455 5:84650328-84650350 CAGGAAATTTAGTTTGAGGATGG - Intergenic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
995087594 5:108132264-108132286 AAGGACTTTCAGGCTGGGCACGG - Intronic
995329327 5:110929496-110929518 CAAGGCATTCAGTCTGGGCGCGG - Intergenic
995338854 5:111033847-111033869 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
995363708 5:111329375-111329397 CAGGGCAATCAGGCTGGAGAAGG + Intronic
996983869 5:129535061-129535083 CAGGACAGTCAGGCAGGAGAAGG + Intronic
997303919 5:132825130-132825152 CAGGAGATGCAGGCTGGTGAGGG - Intronic
998079239 5:139260934-139260956 CAGCTCACTGAGTCTGGGGAAGG - Intronic
998762884 5:145451945-145451967 CAGGTCTTCCAATCTGGGGATGG - Intergenic
999372176 5:151062581-151062603 CAGGACACTGAGGCTTGGGAAGG + Intronic
1000343928 5:160298526-160298548 CTGGGCCTACAGTCTGGGGAGGG + Intronic
1000817761 5:165945128-165945150 CAGGATATTCAGGCTTTGGAGGG - Intergenic
1001076162 5:168629531-168629553 GAAGACATTCAGCCTGGGTATGG - Intergenic
1001426896 5:171628796-171628818 CAGGGCTGTCAGTGTGGGGAGGG - Intergenic
1001942607 5:175751248-175751270 GAGCACATTCACTCTGGGGTAGG - Intergenic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002819483 6:711306-711328 CCTGACACTCACTCTGGGGAGGG - Intergenic
1004457808 6:15807575-15807597 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1004480267 6:16012530-16012552 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1006605095 6:35250370-35250392 CAGGACATACCACCTGGGGATGG + Exonic
1006999914 6:38300853-38300875 CAGGGCAATCAGTCAGGAGAAGG - Intronic
1007155660 6:39740536-39740558 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1007402291 6:41610063-41610085 TACAACATTCAGTTTGGGGATGG + Intergenic
1007651164 6:43423346-43423368 CACAACATTCAGACTGGGCATGG + Intergenic
1009239353 6:61164958-61164980 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1009323139 6:62316187-62316209 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1010181211 6:73088309-73088331 AAGGACAGTGAGTCTGGGCACGG - Intronic
1010312571 6:74404944-74404966 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1010589463 6:77696258-77696280 CAGGACAATCAGGCAGGAGAAGG - Intronic
1010597978 6:77788400-77788422 CAGGACAATCAGGCAGGAGAAGG + Intronic
1010990407 6:82473639-82473661 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1011989994 6:93502765-93502787 TAAGTCATTCAGGCTGGGGAAGG - Intergenic
1012651110 6:101754579-101754601 CAGAACATTCAGTCTCACGAGGG + Intronic
1014660717 6:124167512-124167534 CAGGGCATTCAGGCAGGAGAAGG - Intronic
1015711066 6:136140959-136140981 CAGGACAATCAGGCAGGAGAAGG - Intronic
1016125947 6:140403566-140403588 CTGGACATTCAGTGTAGGTAGGG + Intergenic
1016706662 6:147116712-147116734 AAGGAAATTGAGGCTGGGGAGGG - Intergenic
1017499151 6:155007142-155007164 TAGGGCATTCAGTGTGTGGAGGG + Intronic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1019117273 6:169775097-169775119 CAGTACATTCAGATGGGGGAAGG - Intronic
1020005048 7:4778497-4778519 CAGGACATGGAGTCTGGAGAAGG + Intronic
1020734483 7:11930136-11930158 CAGCAGATTCACACTGGGGAAGG + Intergenic
1020751077 7:12143089-12143111 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1020814434 7:12888163-12888185 CATGACACTCAAACTGGGGAGGG - Intergenic
1021604978 7:22400895-22400917 TAAGACATTTAGTTTGGGGATGG + Intergenic
1023851591 7:44153188-44153210 CAGGAGATTCTGTCTCGGGCTGG + Intronic
1025501791 7:61309956-61309978 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1025547473 7:62195412-62195434 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1026368084 7:69670110-69670132 AAGAACATACAGTCTGGGGGTGG - Intronic
1027800901 7:82747740-82747762 CTGGTCATCCAGTCTGAGGAAGG + Intergenic
1028283185 7:88959611-88959633 GATGAGATTCAGTGTGGGGATGG - Intronic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1030812426 7:113990179-113990201 CAGGACATTGATTATAGGGATGG - Intronic
1031431818 7:121680777-121680799 CAGAAACTTCAGTCTGGAGAAGG - Intergenic
1035186521 7:157130246-157130268 CAGGAGAGTCAGTCAGGGAAGGG + Intergenic
1035697622 8:1611537-1611559 CAGGACAATCAGGCAGGAGAAGG + Intronic
1036950134 8:13132754-13132776 CAGGACTCGCAGTTTGGGGAGGG - Intronic
1038413745 8:27377952-27377974 CAGGGCATTTACTTTGGGGAAGG + Intronic
1039317598 8:36390578-36390600 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1040736046 8:50509910-50509932 CAGGACAATCAGGCAGGAGAAGG - Intronic
1042362491 8:67898399-67898421 CAGGACAATCAGTCAGGAAAAGG + Intergenic
1042419589 8:68569991-68570013 GAAGAGACTCAGTCTGGGGAAGG - Intronic
1042756681 8:72221966-72221988 CAGGACTTATACTCTGGGGAAGG + Intergenic
1043448457 8:80342146-80342168 AAGGACCTTCAGGCTGGGCAAGG - Intergenic
1044751363 8:95419459-95419481 GAGGACATTCAGTATGGGCTAGG - Intergenic
1046436054 8:114191101-114191123 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1046602285 8:116330651-116330673 CAGGGCAATCAGTCAGGAGAAGG + Intergenic
1048189711 8:132276706-132276728 CATGGCATTCAGTCTTGGGGTGG - Intronic
1048459000 8:134604369-134604391 CAGTACAGTCACTCTGGGGCAGG - Intronic
1048540684 8:135339524-135339546 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1048970010 8:139640140-139640162 CAGGGCATTTTGGCTGGGGATGG - Intronic
1050047498 9:1562559-1562581 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
1050329908 9:4535205-4535227 CAGGGCAATCAGGCTGGAGAAGG + Intronic
1050381552 9:5035878-5035900 CAGGGCAGTCAGGCTGGAGAAGG + Intronic
1050884891 9:10751712-10751734 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1051381724 9:16465827-16465849 CAGGGCATTCAGGCAGGAGAAGG + Intronic
1051690991 9:19712093-19712115 CAGCACAAAAAGTCTGGGGAAGG + Intronic
1052536685 9:29756417-29756439 GAGGGCATTCAGGCTGGGCATGG - Intergenic
1053480920 9:38415697-38415719 CAGGCCATTCTGTCTTTGGAGGG + Intronic
1054339698 9:63847572-63847594 CAGGGCAATTAGTCAGGGGAAGG + Intergenic
1057323223 9:94033149-94033171 AAGGACGTGCAGGCTGGGGACGG - Intronic
1058251300 9:102698607-102698629 CAGCAGATTCTGTCTGGTGAAGG - Intergenic
1058937724 9:109784485-109784507 CAGGACATTTAGTGTGAGAAAGG + Intronic
1059298231 9:113291630-113291652 CAGGACCTTCAAGCTGTGGATGG + Exonic
1060917217 9:127398313-127398335 CATGACATGCAGTCTCGGAAAGG + Intronic
1061211534 9:129196306-129196328 CAGGACACTCCCTCTGGAGATGG - Intergenic
1062348798 9:136128683-136128705 CAGGAGAGTCTGTCTTGGGAAGG + Intergenic
1062462256 9:136666841-136666863 CTGGAGATTAACTCTGGGGATGG - Intronic
1203441911 Un_GL000219v1:16514-16536 CAGGAGATTCGGTCGGGGGTGGG - Intergenic
1203512719 Un_KI270741v1:135423-135445 CAGGAGATTCGGTCGGGGGTGGG - Intergenic
1185884208 X:3767713-3767735 CACAACTTTCAGTCTGGGGCAGG - Intergenic
1187070744 X:15885582-15885604 CAGGACATCCTGTGTAGGGATGG - Intergenic
1187645610 X:21343709-21343731 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1187838020 X:23455723-23455745 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1188282487 X:28287147-28287169 CAGAACATGCAGTCTGGGCATGG - Intergenic
1188793882 X:34439108-34439130 TAGGAGGTTCAGTCTTGGGAGGG - Intergenic
1189171024 X:38909634-38909656 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1190071472 X:47283447-47283469 CTGGAAATTAAGTCTGGGCAAGG + Intergenic
1190783339 X:53620194-53620216 CCGCTCATTCAGTCTGGGCATGG + Intronic
1191118179 X:56873121-56873143 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
1191120446 X:56898058-56898080 CAGGGCATTCAGGCAGGAGAAGG + Intergenic
1191187954 X:57633402-57633424 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191804556 X:65120642-65120664 CAGGACAATCAGGCAGGGGAAGG - Intergenic
1192685592 X:73301624-73301646 CAGGGCAATCAGTCAGGAGAAGG - Intergenic
1193007345 X:76635258-76635280 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1193018543 X:76763668-76763690 CAGGACAGTTAGTCTAGGGAAGG + Intergenic
1193247142 X:79242641-79242663 CAGTAGATTCAGTCTGGTGAAGG + Intergenic
1193392083 X:80940695-80940717 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1196172592 X:112606371-112606393 CAGGACAATCAGGCAGGAGAAGG + Intergenic
1197448329 X:126580165-126580187 CAGGACAATCAGGCAGGAGAAGG - Intergenic
1200150460 X:153948934-153948956 CAGGAAAGCCACTCTGGGGAGGG + Exonic
1200298437 X:154946933-154946955 GAAGACATTCAGGCTGGGCACGG + Intronic
1200781169 Y:7217238-7217260 CATGACTTTCAGTCTGGGGCAGG + Intergenic
1201178333 Y:11322927-11322949 CAGGCCAGTCAGTCTGGTGGAGG - Intergenic
1201185114 Y:11393733-11393755 CAGGACAATCAGGCAGGAGAAGG + Intergenic