ID: 986728038

View in Genome Browser
Species Human (GRCh38)
Location 5:10614353-10614375
Sequence GCTAGGCCACAGTAGTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986728038 Original CRISPR GCTAGGCCACAGTAGTACCT AGG (reversed) Intronic
900181032 1:1311108-1311130 CCTCGGCCACAGTAGTCACTGGG - Intronic
900353450 1:2248202-2248224 GCCAGGCCAAAGCAGAACCTAGG - Intronic
900745031 1:4355248-4355270 ACTAGGCCACAGTCACACCTTGG + Intergenic
909013816 1:70362584-70362606 GCTCGGCCTCTGTAGTAACTGGG - Intronic
913703840 1:121398278-121398300 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
913942492 1:125120786-125120808 CCTCAGCCACAGTAGTAGCTAGG - Intergenic
913980191 1:143499987-143500009 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
914074539 1:144325472-144325494 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
914104637 1:144640974-144640996 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
917560587 1:176149989-176150011 GCTATGCAACAGAATTACCTGGG + Intronic
924674531 1:246162069-246162091 GCTAAGCAACAGTAGTTTCTTGG + Intronic
1064446536 10:15398820-15398842 GCTCAGCCACAGTAGGACCAGGG + Intergenic
1064876029 10:19995445-19995467 ACTAGCCCACAGTAGGACCTTGG - Intronic
1066187853 10:33027979-33028001 TCCAGGCCTCAGTAGAACCTTGG - Intergenic
1066953927 10:42148329-42148351 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
1069985267 10:72278616-72278638 GCCAGGCCTCAGGAGAACCTAGG - Intergenic
1070323858 10:75374919-75374941 GCCAGGCCAAGGCAGTACCTAGG + Intergenic
1082888813 11:58116369-58116391 GCTAGGCCACTGGAATAGCTGGG + Intronic
1087442959 11:98208557-98208579 GCCAGGTCACAATAGCACCTGGG + Intergenic
1105255828 13:18743633-18743655 GATAGGCCACAGGGGTCCCTGGG + Intergenic
1105425775 13:20293610-20293632 GCTAGCCCACGGCAGTCCCTCGG + Intergenic
1114679366 14:24471883-24471905 GCTAGGGCCCAGTAGCACCCTGG + Intergenic
1114919508 14:27309072-27309094 TGGAGGCCACAGTATTACCTTGG - Intergenic
1118750838 14:68807026-68807048 GCTAGGACAAAATAGTACCTTGG - Intergenic
1202939627 14_KI270725v1_random:135366-135388 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1123393513 15:19900527-19900549 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1124578243 15:30928016-30928038 GCTAGGGCAGTGTAGTACCCAGG + Intronic
1131190206 15:90309074-90309096 GTTAGGCCACAGTAGTTCTAAGG + Intronic
1136696058 16:32083297-32083319 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
1136699515 16:32117902-32117924 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136715802 16:32280083-32280105 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136752111 16:32649684-32649706 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1136768143 16:32810032-32810054 CCTGAGCCACAGTAGTAGCTGGG + Intergenic
1136771401 16:32844989-32845011 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1136796552 16:33026549-33026571 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
1136800006 16:33061073-33061095 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136822481 16:33330778-33330800 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136829044 16:33387317-33387339 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136834110 16:33486099-33486121 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1136899178 16:34016436-34016458 CCTTAGCCACAGTAGTAGCTGGG - Intergenic
1136957903 16:34805082-34805104 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1137084003 16:36100175-36100197 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
1139837744 16:69853333-69853355 GCAAGGGCACAGTAGTTTCTTGG - Intronic
1140328000 16:74024366-74024388 GATAGTCCACAGTCGTGCCTGGG + Intergenic
1203010806 16_KI270728v1_random:238421-238443 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1203054252 16_KI270728v1_random:909668-909690 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1203070533 16_KI270728v1_random:1072048-1072070 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1203073825 16_KI270728v1_random:1107100-1107122 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1142979489 17:3663446-3663468 GCTTGGCCACAGCAGTGGCTGGG - Exonic
1145055185 17:19698465-19698487 GCTCAGCCACTGGAGTACCTGGG + Intronic
1145710199 17:26964084-26964106 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1146820667 17:35981718-35981740 TCTAGGCCTCAGTAGTCCCAGGG - Intergenic
1148833364 17:50451050-50451072 GCTAGGCCTCCGGAGTAGCTGGG + Intronic
1149067839 17:52501302-52501324 GCTAGGCCACAGTTTGCCCTGGG - Intergenic
1154435196 18:14337041-14337063 GATAGGCCACAGGGGTCCCTGGG - Intergenic
1154518053 18:15196549-15196571 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
1162485642 19:10959024-10959046 GCCAGGCCCCAGAAGGACCTGGG - Intergenic
1202670074 1_KI270709v1_random:41589-41611 CCTCAGCCACAGTAGTAGCTAGG - Intergenic
1202679954 1_KI270712v1_random:1483-1505 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
932143846 2:69302031-69302053 CCTATGACACTGTAGTACCTAGG + Intergenic
934077595 2:88441141-88441163 GCAGGGCCACAGAAGAACCTGGG + Intergenic
936765625 2:115845143-115845165 GCTTGGAGACAGAAGTACCTTGG + Intronic
937979514 2:127606700-127606722 CCTGGGCCACAGCAGTCCCTGGG - Intronic
938517970 2:132036795-132036817 CCTCAGCCACAGTAGTAGCTGGG + Intergenic
942547423 2:177079531-177079553 GCTGGACCACAGTGGTGCCTGGG + Intergenic
945675936 2:212855694-212855716 ACTAGGCAACAGTAGGATCTAGG - Intergenic
946228956 2:218279941-218279963 GGTAGGCCACAGTAGCCCCAGGG - Intronic
1172315244 20:33948929-33948951 GTTAGGCAGCAGTAGTAACTGGG + Intergenic
1172486822 20:35303559-35303581 CCTAGGCCACAGCAGGCCCTGGG + Exonic
1175926156 20:62472576-62472598 GGGAGGCCACAGTGGCACCTGGG - Intronic
1176583562 21:8551719-8551741 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1180266372 22:10528650-10528672 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1181390049 22:22573652-22573674 GATAAACCGCAGTAGTACCTTGG - Intergenic
1184265610 22:43344184-43344206 GCCAGGCCAGAGCAGTTCCTGGG - Intergenic
1184693608 22:46128269-46128291 GCTGGGCCACAGGTGTCCCTGGG + Intergenic
1184757703 22:46526248-46526270 GCTTGGCCACAGTAGCCCTTTGG + Intronic
1203288996 22_KI270735v1_random:16519-16541 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
1203324767 22_KI270738v1_random:3702-3724 CCTCAGCCACAGTAGTAGCTAGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952832721 3:37578545-37578567 GCCATGCCACAGTGGTCCCTCGG + Intronic
957057249 3:75453201-75453223 GCTAAGTCACATTAGTTCCTGGG + Intergenic
957685949 3:83503398-83503420 TCCAGGCCAGAGCAGTACCTTGG + Intergenic
958052511 3:88366311-88366333 GCTAAGCCACAGTTGTATATGGG + Intergenic
969496838 4:7531059-7531081 GATAGGCCACAGGAATGCCTCGG + Intronic
971292915 4:25360828-25360850 TCTAGGCAGCAGTAGCACCTTGG - Intronic
973726702 4:53784174-53784196 GCTAAGCCGTAGTAGTACCCAGG + Intronic
984454269 4:179945151-179945173 GCTAAGGCCCAGTTGTACCTTGG - Intergenic
985590376 5:761453-761475 GCTGGGCCACAGCAGAAGCTGGG + Intronic
986728038 5:10614353-10614375 GCTAGGCCACAGTAGTACCTAGG - Intronic
989724233 5:44568993-44569015 GATAGGCCACAGAAGTCCTTGGG - Intergenic
993211914 5:84962286-84962308 GCTAGGTCACAACAGTTCCTGGG + Intergenic
993694329 5:91042374-91042396 GCTAGGCCAGAGTTGTCCCTTGG + Intronic
999788353 5:154912881-154912903 ACAAGGACACAATAGTACCTGGG + Exonic
1003503993 6:6725103-6725125 GCTAGGACAAAGGAGTGCCTTGG + Intergenic
1012887543 6:104862264-104862286 TCTGGGCCACAGAAGAACCTGGG - Intergenic
1018926086 6:168207943-168207965 GCTAGGCCATAGCAGAAGCTGGG - Intergenic
1022144760 7:27526076-27526098 TCTAGGTCACAGTAATCCCTAGG - Exonic
1025320596 7:58089246-58089268 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1025478901 7:60958235-60958257 CCTCAGCCACAGTAGTAGCTAGG - Intergenic
1025482121 7:60993886-60993908 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1025562243 7:62381983-62382005 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1026979704 7:74519190-74519212 GCTAGGCCACCGGAGGACCTGGG - Intronic
1036306966 8:7610071-7610093 CCTAGGCCCCTGTAGTCCCTGGG - Intergenic
1036357814 8:8058058-8058080 CCTAGGCCCCTGTAGTCCCTGGG - Intergenic
1036893134 8:12608888-12608910 CCTAGGCCCCTGTAGTCCCTGGG + Intergenic
1039331217 8:36538958-36538980 GGTTGCCCACAGTAGTAGCTGGG + Intergenic
1040899448 8:52403094-52403116 GCTGGGGCACAGTAGCAACTTGG + Intronic
1052360202 9:27547112-27547134 GCTCTGCCAAAGTAGCACCTAGG + Exonic
1052644724 9:31218973-31218995 TCTCGGCCACAGGAGTAGCTGGG - Intergenic
1052839776 9:33282647-33282669 GCTAGACCACATTAGTGCATTGG + Intergenic
1052847779 9:33352332-33352354 GCTAGGCCACAGTTGGGCCTAGG + Intronic
1054941549 9:70748333-70748355 GCTAGGTCACTGTTGTACCCTGG - Intronic
1061970313 9:134041417-134041439 CAGAGGCCACAGTAGTGCCTGGG - Intronic
1203613521 Un_KI270749v1:29490-29512 CCTCAGCCACAGTAGTAGCTGGG - Intergenic
1191980370 X:66918199-66918221 TCTAGGCCACAAAAATACCTTGG + Intergenic
1193336315 X:80294197-80294219 GCTAGGCCAGAGATGTACATTGG + Intergenic
1193751423 X:85350004-85350026 GCAAGGCCACAGTAATTCCATGG - Intronic