ID: 986729563

View in Genome Browser
Species Human (GRCh38)
Location 5:10625160-10625182
Sequence GAGGCTGTTTAGGCCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986729559_986729563 -4 Left 986729559 5:10625141-10625163 CCTGTGCTGTTTTGCCAAAGAGG 0: 1
1: 0
2: 1
3: 18
4: 138
Right 986729563 5:10625160-10625182 GAGGCTGTTTAGGCCCAATCAGG 0: 1
1: 0
2: 1
3: 10
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986729563 Original CRISPR GAGGCTGTTTAGGCCCAATC AGG Intronic
909126448 1:71677114-71677136 TAGGCTGTTTAGCTCCAAGCTGG + Intronic
911685026 1:100765639-100765661 GAGTCAGTTTAGGTCAAATCTGG + Intergenic
913046240 1:115075731-115075753 GAGGCAGTTTTGGCCTCATCGGG - Intronic
915623336 1:157099345-157099367 TCGGCTTTGTAGGCCCAATCAGG + Exonic
917256101 1:173117976-173117998 GAAGCTGATTTGGCCAAATCTGG - Intergenic
1067051596 10:43024743-43024765 GATGCTCTCTAGTCCCAATCTGG + Intergenic
1070565994 10:77604285-77604307 GAGGCTTTTTATGCCCACTGTGG - Intronic
1071965218 10:90845057-90845079 GGGGCTGTGTAGGCACAATCAGG + Intronic
1072295011 10:94000367-94000389 GAGGATGCTTAGGCCCAAACAGG - Intronic
1076889900 10:133278336-133278358 GAGCCTGTTCTGGCCCAAGCTGG - Intergenic
1079456032 11:20637022-20637044 GAGGCTTTTTAGACCCATTGAGG + Intronic
1082162657 11:48901253-48901275 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1082175051 11:49049251-49049273 GAAGCTGTTCTGGCCCAGTCAGG - Intergenic
1082238768 11:49851481-49851503 GAGGCTGTTCTGGCCCAGTCAGG + Intergenic
1082243376 11:49892846-49892868 GAGGCTGTTCTGGCCGAGTCAGG - Intergenic
1082657874 11:55873672-55873694 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1086697804 11:89864670-89864692 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1086708358 11:89979818-89979840 GAGGCTGTTCTGGCCCAGTCAGG + Intergenic
1086715082 11:90052824-90052846 GAGGCTGTTCTGGCCCAGTCAGG - Intergenic
1091442168 12:519731-519753 GAGGCTCTTTCAGCCGAATCAGG + Intronic
1096512980 12:52142062-52142084 CAGGCTGTCTAGGCCCCAACCGG - Intergenic
1098357356 12:69624259-69624281 GAGGCTGATTAGGCCGACTCTGG - Intergenic
1099939951 12:89174790-89174812 GAGTCTGTTTAGGAACAATGTGG + Intergenic
1117077368 14:52117873-52117895 GAGGCTGTTAAGGACAAAGCAGG + Intergenic
1117388507 14:55240725-55240747 GAGGCTGTTAAGGACAAAGCAGG - Intergenic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1128223759 15:65987296-65987318 GTGGCTGTTTAAGCCCAGGCTGG - Intronic
1129980283 15:79863111-79863133 GAGGCTGTTGAGGGACAGTCTGG - Intronic
1131869447 15:96746635-96746657 GAGGTTGTTTTGTCCCAACCCGG + Intergenic
1136743352 16:32559952-32559974 GAGACTGTTTATGGCCAATTTGG + Intergenic
1141585224 16:85028773-85028795 GAGGCTGTTCCTGCTCAATCTGG - Intronic
1203026247 16_KI270728v1_random:515277-515299 GAGACTGTTTATGGCCAATTTGG - Intergenic
1203045474 16_KI270728v1_random:819154-819176 GAGACTGTTTATGGCCAATTTGG + Intergenic
1148875514 17:50684660-50684682 GAGGCAGCTTAGGCCCTATGAGG - Intronic
1149527416 17:57367527-57367549 GGGGCTGTTCCGGCCCAATGGGG - Intronic
1152016278 17:77752856-77752878 GAGACTGTTTAAGCCCAAGATGG - Intergenic
1153762573 18:8346307-8346329 GAGGCTGGAAAGTCCCAATCCGG + Intronic
1161344198 19:3759871-3759893 GAGGCTCTTCAGGACCAGTCTGG + Exonic
1161583514 19:5093130-5093152 GTGGCTGTTGAGGCCCCTTCAGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166141112 19:40805869-40805891 CAGGCAGTTGAGGCCCATTCAGG + Intronic
929906326 2:46049543-46049565 GAGTCTGCTTAGGAACAATCAGG - Intronic
932591783 2:73071775-73071797 GCGGTTGATTAGGGCCAATCGGG - Exonic
935953383 2:108351280-108351302 GGGGCTGTTTAGGCCAACCCTGG - Intergenic
941501685 2:166286335-166286357 GAGGTTGTCTACCCCCAATCAGG - Exonic
942201707 2:173577899-173577921 CAGGAAGTTTAGGCCCACTCTGG - Intergenic
942201833 2:173578820-173578842 TAGGAAGTTTAGGCCCACTCTGG + Intergenic
1170789834 20:19498518-19498540 GAGGCTGCATAGGGCAAATCAGG - Intronic
1183292391 22:37010700-37010722 GAGGCTGTTTCTGCCAAAACTGG + Intergenic
950681053 3:14585399-14585421 GAGGCTGTGTGGGCCCCATGGGG - Intergenic
952978948 3:38719819-38719841 GAGGCTGTTGGTGCCCACTCAGG + Intronic
953052937 3:39362221-39362243 GAGGCAGTCTGGGCACAATCTGG - Intergenic
954972656 3:54664175-54664197 TAGGCTTTTTAGGGCCAGTCTGG + Intronic
962656623 3:137551863-137551885 GAGGCTGTGTAGGCCTAGGCTGG - Intergenic
969516252 4:7649675-7649697 GAGGGTGATTAGGCCCAGGCGGG + Intronic
976053395 4:81033381-81033403 GAGGCTGATAAGGCACACTCTGG - Intronic
984953599 4:185024260-185024282 GAAGCTGACTTGGCCCAATCTGG - Intergenic
986729563 5:10625160-10625182 GAGGCTGTTTAGGCCCAATCAGG + Intronic
999201555 5:149820374-149820396 GAGGCTGGCTAGACCCAAGCAGG - Intronic
1003682912 6:8273445-8273467 AAGTCTGTTTAGGCCCAACCAGG + Intergenic
1010584094 6:77636315-77636337 CAGGCGGTTTAAGCCCATTCAGG + Intergenic
1010906282 6:81494119-81494141 AAGGCTCTTAAGGGCCAATCTGG - Intronic
1012601813 6:101107784-101107806 TAGGCTGTCTAGGGGCAATCAGG + Intergenic
1024995532 7:55270916-55270938 GAGGCAGTTAAGGCCCAAGGTGG - Intergenic
1026971761 7:74472871-74472893 GAGGCTGGACAGGCCCAAGCTGG + Intronic
1035910161 8:3557573-3557595 GAGGCTGTTGGGGCCAATTCAGG - Intronic
1045292176 8:100843022-100843044 GAGGCTGCCTAAGCCCCATCTGG + Intergenic
1047109071 8:121768429-121768451 GAGGGTGTTTAGGGACAATTTGG - Intergenic
1047980860 8:130180521-130180543 GGGGCTGTTTAAGCCAAAACAGG - Intronic
1062357144 9:136170385-136170407 GAGACTGTCTGGGCCCAACCTGG - Intergenic