ID: 986731575

View in Genome Browser
Species Human (GRCh38)
Location 5:10638417-10638439
Sequence GTGGGCAGGAGGAAAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 499}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986731575_986731587 25 Left 986731575 5:10638417-10638439 CCTGCTGTTTTCCTCCTGCCCAC 0: 1
1: 0
2: 6
3: 40
4: 499
Right 986731587 5:10638465-10638487 ATATCTGTTCCTCCTCAGAAAGG No data
986731575_986731588 26 Left 986731575 5:10638417-10638439 CCTGCTGTTTTCCTCCTGCCCAC 0: 1
1: 0
2: 6
3: 40
4: 499
Right 986731588 5:10638466-10638488 TATCTGTTCCTCCTCAGAAAGGG 0: 1
1: 1
2: 1
3: 50
4: 244
986731575_986731589 27 Left 986731575 5:10638417-10638439 CCTGCTGTTTTCCTCCTGCCCAC 0: 1
1: 0
2: 6
3: 40
4: 499
Right 986731589 5:10638467-10638489 ATCTGTTCCTCCTCAGAAAGGGG 0: 1
1: 0
2: 2
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986731575 Original CRISPR GTGGGCAGGAGGAAAACAGC AGG (reversed) Intronic
900034225 1:393527-393549 CAGGGAAGGAGGGAAACAGCAGG - Intergenic
900055060 1:623417-623439 CAGGGAAGGAGGGAAACAGCAGG - Intergenic
901367389 1:8764553-8764575 GTGGGCTGAATGCAAACAGCCGG + Intronic
902342928 1:15796129-15796151 GAGGGGAGGAGGAAGACAGGAGG + Intergenic
904311407 1:29632116-29632138 ATGGGCACAAGGAACACAGCAGG - Intergenic
904351360 1:29908968-29908990 GGGGGCAGCTGGACAACAGCTGG - Intergenic
904663182 1:32100356-32100378 ATGGGCAGGAGGGAATCACCAGG - Intronic
904916950 1:33977149-33977171 GGGTGCTGGAGGTAAACAGCTGG + Intronic
904999571 1:34657757-34657779 GTGGGAAGGAGGAAAAAGCCAGG - Intergenic
906148624 1:43575021-43575043 GTGGGCAGGAAGCAGGCAGCAGG + Intronic
906154646 1:43606789-43606811 GTGGCCCGGTGGAGAACAGCAGG - Intronic
906535601 1:46549425-46549447 TTGGGCAGGAGAAAAAGAACTGG + Intronic
906790465 1:48654641-48654663 GATGGCAGGAGGAAGGCAGCAGG + Intronic
907272345 1:53298377-53298399 GTGGGCAGGATGGGATCAGCAGG + Intronic
907326432 1:53641426-53641448 CTGGGGAGGAGGAAAACAGGTGG + Intronic
907821884 1:57978115-57978137 CTGGGCAGGAAGAACAAAGCTGG + Intronic
908010050 1:59766761-59766783 GGGGGGAGGAAGAAAAAAGCAGG - Intronic
908735661 1:67273678-67273700 GTGGATAGGAGGAAAAGAGCAGG - Intergenic
911326454 1:96474653-96474675 GAGGGCGGTAGGAAACCAGCGGG + Intergenic
911620215 1:100058060-100058082 GTGGGCAGCAAGAGAACCGCTGG - Intronic
912476030 1:109935572-109935594 GTGGGCAGGAAGGAAACACATGG - Intergenic
914005813 1:143731508-143731530 GTGGGCAGGAAGAACCCATCAGG - Intergenic
914317007 1:146522974-146522996 GTGGGCAGGGAGCAGACAGCAGG - Intergenic
914497348 1:148210386-148210408 GTGGGCAGGGAGCAGACAGCAGG + Intergenic
914517994 1:148390528-148390550 GTGGGCAGGAAGAACCCATCAGG - Intergenic
915341982 1:155181670-155181692 GGGGGCATGAGGAAAAAAGAAGG - Intronic
915352050 1:155232979-155233001 GTGGGCAGGAAGAAACAGGCAGG - Intergenic
916579626 1:166095674-166095696 GGGGGCAGGAGGAAAAGGGCAGG + Intronic
917469251 1:175312386-175312408 GTGGGCAGAAAGAAAACAAAAGG - Intergenic
920292836 1:204936073-204936095 TTGGGCAGGAGGAGAACAGGTGG - Intronic
920351849 1:205343162-205343184 GGGGCCAGGAGGGAAACAGATGG - Intronic
920694832 1:208174364-208174386 GAGGGAAGGAGGAACACAGAAGG + Intronic
920815282 1:209325479-209325501 GTGGGGAGGAGGAAGCCAACAGG - Intergenic
920822920 1:209398185-209398207 TTGGGCTGGGGCAAAACAGCAGG - Intergenic
921074983 1:211693371-211693393 GTGGGCAGTAGGAAGAAAGATGG - Intergenic
921351929 1:214244746-214244768 GTGGGCAGGAGGGCAGGAGCCGG - Intergenic
922256581 1:223897696-223897718 CAGGGAAGGAGGGAAACAGCAGG - Intergenic
923020546 1:230160009-230160031 GTGGGGAGGAGGGAAGCACCTGG - Intronic
924357542 1:243197853-243197875 ATGGGCATGAAGAAAACTGCTGG + Intronic
924362507 1:243255811-243255833 CTGGGCTGGAGGAAAAGGGCGGG + Intergenic
924493033 1:244558731-244558753 GTGGGCAGGAGGAGAAGGGGAGG - Intronic
1063014573 10:2063450-2063472 GATGGCAGAAGGAAAACAGAGGG + Intergenic
1063258220 10:4352893-4352915 GTGTTCAGGAGGAAAAGAGCTGG + Intergenic
1063269754 10:4494716-4494738 TTGGACAAGAGGAAACCAGCAGG + Intergenic
1063817002 10:9787074-9787096 ATGTGCAGGAGGTAAACTGCAGG + Intergenic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1065171336 10:23033565-23033587 GTGTGCATGAGGAAAAGAGGAGG + Intronic
1067278162 10:44852309-44852331 GAGGAGAGGAGGAAGACAGCTGG + Intergenic
1067878170 10:50022226-50022248 TTGGGGAAAAGGAAAACAGCGGG + Intergenic
1069225156 10:65933892-65933914 CTGGGTAGGAGGAAATCTGCTGG + Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071503541 10:86219616-86219638 GAGGGCAGGAGGGAGAGAGCTGG + Intronic
1072914151 10:99526929-99526951 ATGGGCAGGAGGGAAACAGGTGG + Intergenic
1073280091 10:102347599-102347621 GTGGGCATGAGAAAAGGAGCAGG + Intronic
1073748554 10:106497622-106497644 GTGGGCAGGAAGAACCCATCAGG + Intergenic
1075090821 10:119443495-119443517 GTGAGGAGGAGGGAGACAGCTGG - Intronic
1075380286 10:122013234-122013256 GAGGAAAGGAAGAAAACAGCAGG + Intronic
1075756659 10:124817648-124817670 GTGGTCAGGGTGAAAACTGCAGG - Intronic
1075969218 10:126638518-126638540 GTGGGCAGAATGAGACCAGCTGG - Intronic
1076348195 10:129795066-129795088 CTGGGCAGTAGGAAGCCAGCAGG - Intergenic
1076357855 10:129865909-129865931 GTGGCCATGAGGACCACAGCAGG - Intronic
1076484097 10:130804813-130804835 GAGGGGAGGAGGAAGACAGTAGG - Intergenic
1076893496 10:133296893-133296915 TTGGGGATGAGGAAAACAGGTGG + Intronic
1077917397 11:6620324-6620346 GTGGCCTGTAGGACAACAGCAGG - Intergenic
1078082923 11:8217190-8217212 GTGGGTGGGAGGACAAGAGCAGG + Intergenic
1079560063 11:21811091-21811113 GTGGGCAGGAGGCACAGAGCCGG + Intergenic
1079582202 11:22079573-22079595 TTGGGCAGGAGGAGGCCAGCTGG + Intergenic
1080118359 11:28645969-28645991 CTGGGCAAGAGGAACAAAGCTGG + Intergenic
1081523856 11:43909910-43909932 GTGGGATGGAGCGAAACAGCAGG - Intronic
1081666460 11:44919766-44919788 GTGGGCAGGAGGAGGACACAGGG - Intronic
1081698488 11:45136473-45136495 ATAGGCAGGTGGAAGACAGCTGG + Intronic
1083155076 11:60817699-60817721 ATGGGCAGAAAGGAAACAGCAGG + Intergenic
1083701155 11:64478442-64478464 GGAGGCAGGAGGAAGACAGGAGG + Intergenic
1083768214 11:64852458-64852480 GTGGGGAGGGGGGAAACAGTTGG - Exonic
1083822832 11:65182361-65182383 CTGGGCAGGTGGGACACAGCAGG - Intronic
1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG + Intronic
1083948885 11:65942849-65942871 GGGGACGGGTGGAAAACAGCAGG + Intergenic
1084937042 11:72592387-72592409 ATGGGGAGGAGGAGACCAGCAGG + Intronic
1084959715 11:72710082-72710104 GTGCCCAGGAGGGAGACAGCAGG + Intronic
1085121906 11:73972854-73972876 GTGGGCATGAGCAAGTCAGCTGG - Intergenic
1085770026 11:79316756-79316778 GTGGTGAGGAGCAAAACACCAGG - Intronic
1086401030 11:86461026-86461048 GAGGGCAGGATGACAGCAGCAGG + Intronic
1087821409 11:102716964-102716986 GTGGGCAGGAGGAAGAAATTGGG + Intronic
1088184070 11:107144095-107144117 TTAGGCTGGAGGAAAAAAGCAGG + Intergenic
1088188225 11:107197291-107197313 GAGGGAAGGAGGAAAAGATCAGG - Intergenic
1088641038 11:111873068-111873090 GTAGGCAATAGGAAAACATCCGG - Intergenic
1089201904 11:116729703-116729725 TTGGGCAGGAGGAATCCAGGAGG + Intergenic
1089643625 11:119863983-119864005 GAGGGCAGGAGGAAGGCAGGGGG - Intergenic
1089759607 11:120713419-120713441 GAGAGCAGGAGGAAGACAGAGGG + Intronic
1089986497 11:122819074-122819096 GTGGGCAGGAAGAACACATTGGG + Intergenic
1090169312 11:124584816-124584838 GTGGGGAGAAGGAAAAGAGAAGG + Intergenic
1090398429 11:126434021-126434043 GTGGGCAGGGGGAGAGCAGGGGG + Intronic
1091568413 12:1663764-1663786 GAAGGAAGGAGGAAAACAGGAGG + Intergenic
1091568424 12:1663800-1663822 GAGGGAAGGAGGAAAACAGGAGG + Intergenic
1091568434 12:1663835-1663857 GAAGGAAGGAGGAAAACAGGAGG + Intergenic
1091785337 12:3239837-3239859 GTGCAGGGGAGGAAAACAGCTGG + Intronic
1091798184 12:3309082-3309104 GTGGGCTGGAGGGAGACAGTTGG + Intergenic
1092526700 12:9314032-9314054 CTGTGCAGGATGCAAACAGCTGG - Intergenic
1092540573 12:9417747-9417769 CTGTGCAGGATGCAAACAGCTGG + Intergenic
1092577157 12:9798257-9798279 GTGGTCAGGAGGTAAAGTGCTGG + Intergenic
1092680273 12:10971185-10971207 GTAGGGAGGAGGAAAACAAGAGG - Intronic
1092947652 12:13471876-13471898 CAGGGCAGGAGGAAATGAGCTGG + Intergenic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1096089573 12:48889960-48889982 TTGGGCAGGAGGGAAGCACCTGG - Intergenic
1096238367 12:49944916-49944938 ATGGGCAGGAGGGAAATGGCAGG + Intergenic
1096265120 12:50116556-50116578 AAGGGCTGGAGGAAAAGAGCTGG - Intronic
1096500859 12:52063176-52063198 CTGGGGAGGATGAACACAGCAGG - Intergenic
1096750480 12:53755839-53755861 TTGGGCAAGATGAAGACAGCTGG - Intergenic
1096870655 12:54590144-54590166 AGGGCCAGGTGGAAAACAGCTGG + Intergenic
1098490533 12:71070985-71071007 CTAGGGAGGAGGAAAAAAGCTGG + Intronic
1098495911 12:71135407-71135429 GAGAGCAGGAGGAAAACAAGAGG + Intronic
1099574718 12:84363738-84363760 GTGGGCAGAATGAATACAGTGGG + Intergenic
1099920990 12:88956896-88956918 TTTGGCATGAGGAAAGCAGCAGG - Intergenic
1100610967 12:96192326-96192348 GTGGACAGGAGGAGCACAGAGGG - Intergenic
1101131562 12:101696649-101696671 GAGGGCTGTAGGAAAACAGGTGG + Intergenic
1102963041 12:117105970-117105992 GTGGGCAGGAGGAACTCATCAGG + Intergenic
1103526233 12:121570555-121570577 GTGTGGAGGATGAAAGCAGCCGG - Intronic
1103699442 12:122841193-122841215 TTGGGCAGGAGGACGGCAGCGGG - Intronic
1104721959 12:131049354-131049376 GTGTGCAGGAGGCACACAGGTGG - Intronic
1105585731 13:21741205-21741227 GTGGGCAGGAGGAACACTCTAGG - Intergenic
1105623449 13:22090673-22090695 GTGAGCAGGAGAAGAACAGGTGG + Intergenic
1106375548 13:29183341-29183363 ATGGAGATGAGGAAAACAGCAGG + Intronic
1107419719 13:40234911-40234933 CTGGGCAGAAGGAAAAAGGCTGG + Intergenic
1107557817 13:41533290-41533312 GTGGGCAAGAGGAACACGGTAGG - Intergenic
1108825081 13:54403564-54403586 GAGGGCAGGAAGAATGCAGCAGG - Intergenic
1109148393 13:58812447-58812469 AAGGGCAGAAGGAAAACAACTGG - Intergenic
1109698933 13:65999548-65999570 GTGAGCAGGCAGAAAACAGGAGG - Intergenic
1111877020 13:93910275-93910297 GTGGGCAAGAGAAAGATAGCTGG - Intronic
1112022868 13:95386626-95386648 GTGGGCAGGAAGAACTCATCAGG + Intergenic
1112130672 13:96520296-96520318 CTGGGCAGGAAGAACAAAGCTGG - Intronic
1112429352 13:99336917-99336939 GTGGGAAGGAGGAAGAGAGGTGG - Intronic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1112752795 13:102598656-102598678 ATGAGTGGGAGGAAAACAGCTGG + Intronic
1113074199 13:106451964-106451986 GAGTGCAGAAGGAAAAGAGCAGG + Intergenic
1113179826 13:107612260-107612282 GAGGGGAAGAGGAAAAAAGCAGG + Intronic
1113544831 13:111140324-111140346 GTGTCATGGAGGAAAACAGCAGG + Intronic
1117047568 14:51828456-51828478 GGGGGCAGGAGGAAAAAAGGAGG + Intronic
1117727915 14:58692479-58692501 GGAGTCAGGAGGAAGACAGCTGG + Intergenic
1118133541 14:62995637-62995659 GTGGACAAGAGAAACACAGCAGG - Intronic
1119336838 14:73840436-73840458 GAGGCCACGAGGAAAGCAGCAGG + Intergenic
1120016296 14:79477706-79477728 GTGGGTTCAAGGAAAACAGCAGG + Intronic
1120303983 14:82744479-82744501 GGTGACAGGAGAAAAACAGCTGG + Intergenic
1120693999 14:87623413-87623435 GTGGGCATGAGGTAAACACATGG + Intergenic
1121006772 14:90495723-90495745 CTGGGCACAAGGAAAACAGTGGG + Intergenic
1121055113 14:90845763-90845785 GGGGGCAGGAGGAGAAATGCTGG + Intergenic
1121824512 14:96999644-96999666 GTGGGCAGAATGAACACAGCGGG - Intergenic
1122094155 14:99359212-99359234 GTGGGGAGGAGGAGAGCATCAGG - Intergenic
1122448122 14:101782846-101782868 GGGGGGAGGAGGAAAAGAGAGGG - Intronic
1122913020 14:104843084-104843106 GTGGGGAGGAGGAGGAGAGCAGG - Intergenic
1122938388 14:104970349-104970371 GGGGGCTGGAGGAACAGAGCTGG - Intronic
1124021998 15:25933685-25933707 GAGGGAGGGAGGAAAACAGTAGG + Intergenic
1124492572 15:30167273-30167295 GTAGAAAGAAGGAAAACAGCAGG + Intergenic
1124750962 15:32371052-32371074 GTAGAAAGAAGGAAAACAGCAGG - Intergenic
1126064949 15:44819502-44819524 ATGGGCACGATGGAAACAGCTGG + Intergenic
1126546172 15:49877011-49877033 GTGAGCAGGAAGAAGAGAGCAGG + Intronic
1127397986 15:58558368-58558390 GTGAGAAGTAAGAAAACAGCTGG - Intronic
1128313151 15:66644318-66644340 GGGGTCAGGCAGAAAACAGCTGG - Intronic
1128441028 15:67708675-67708697 ATGGGCAGGAGGAAGAAGGCAGG - Intronic
1128778254 15:70340501-70340523 GTGGGCTGATGGAAAACAGCCGG - Intergenic
1130174413 15:81553366-81553388 TTGGGCAGCAGGAAGACACCAGG - Intergenic
1130684007 15:86021335-86021357 GTGGGCAGGAGGTAACCACAGGG - Intergenic
1130905592 15:88238820-88238842 GTGTGCAAGAGCAAAACAACTGG - Intronic
1132986407 16:2769815-2769837 GCGGGCAGGAGGAGAACACAGGG - Intronic
1133109994 16:3542312-3542334 CAGGGCAGAAGGAAAACACCCGG + Intronic
1133964057 16:10518732-10518754 GTGGGGAGGCTGCAAACAGCAGG - Intergenic
1134025504 16:10949909-10949931 ATGGGCAGGAGGAAAAGAGCAGG - Intronic
1134174284 16:11993313-11993335 GTGGGGAGGAGAAAACAAGCAGG - Intronic
1134447680 16:14343248-14343270 GTGAGCTGGAGGAAAATGGCGGG - Intergenic
1134449361 16:14354113-14354135 GAGGGAAGGAGGAAAAGAGGGGG + Intergenic
1135201348 16:20440194-20440216 ATGGCCAGAAGCAAAACAGCTGG - Intronic
1135217761 16:20587670-20587692 ATGGCCAGAAGCAAAACAGCTGG + Intergenic
1135398586 16:22149764-22149786 CTGGGGAGGAGGAAAAGAGGAGG - Intronic
1135598155 16:23759102-23759124 CTGGGAGGGAGAAAAACAGCAGG - Intergenic
1135733902 16:24915784-24915806 GTGGGCAGGAGGGAAACTAAGGG + Intergenic
1135849482 16:25950142-25950164 GTGGGCTGGAGGAAAAAAAATGG + Intronic
1136240293 16:28939087-28939109 GTGGGCAGGGGGAGGACTGCTGG + Intronic
1136631913 16:31493827-31493849 GTGGGCAGGAGAACCCCAGCTGG - Intronic
1137364374 16:47848116-47848138 GTGGGCAGGTGGTAACCAGGAGG + Intergenic
1137396246 16:48117760-48117782 GTGTGAAGGAGGCTAACAGCAGG + Intronic
1137881189 16:52050219-52050241 GTGGGTAGGGGGAAAATAGAGGG + Intronic
1138619533 16:58199657-58199679 GTTGCCAGGTGGCAAACAGCAGG - Intergenic
1138925123 16:61581466-61581488 GACGGCAGGAGGAAGACAACAGG - Intergenic
1141169622 16:81682996-81683018 GTGCCCAGCAGGAAAAGAGCTGG - Intronic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1141992505 16:87618570-87618592 GTGGCCAGGTGGAAAAAGGCTGG - Intronic
1142228674 16:88889315-88889337 GAGGGCAGGAGGAAAGGAGGGGG + Intronic
1143032334 17:3974571-3974593 GTGAGCAGGAGGGTAGCAGCAGG - Intergenic
1143262067 17:5606890-5606912 GTGGGCAGGAGGACTAGAACAGG - Intronic
1143320307 17:6064260-6064282 GTAGGCAGGAGGAGCAAAGCAGG + Intronic
1143660019 17:8318945-8318967 GTGGGCAGGAGGGGTCCAGCGGG + Intronic
1143844264 17:9760922-9760944 GGGGTCTGGAGGAAGACAGCTGG + Intergenic
1144021132 17:11240967-11240989 GGGAGCAGGAGGAGAACCGCGGG - Intergenic
1144919719 17:18753230-18753252 GTGGGCCTGAGTAAAACAGTGGG + Intronic
1144948176 17:18980432-18980454 TTGGGCATGAGGAGCACAGCGGG + Intronic
1145291042 17:21546103-21546125 GGGGGAATGTGGAAAACAGCAGG - Intronic
1145787072 17:27601184-27601206 GCAGGAAGGAGGAAAAGAGCTGG - Intronic
1146006338 17:29163003-29163025 GTGTGCAGGAAGATAACAGATGG + Intronic
1146188522 17:30744695-30744717 GTGGTCAGGAGAAAAGAAGCAGG - Intergenic
1146333395 17:31949008-31949030 GTGGTCAGGAGAAAAGAAGCAGG - Intronic
1146441156 17:32896361-32896383 GTGGGCAGGAGGAAGGAACCAGG - Intergenic
1146624011 17:34422371-34422393 TTGGGCAGGAGTTAAAAAGCAGG - Intergenic
1146803575 17:35847007-35847029 GAGGCCACGAGGAAAGCAGCAGG - Exonic
1147617837 17:41840704-41840726 GTGGGCAGCATGAAAACAAGAGG + Intronic
1147927293 17:43953708-43953730 GTGGGAAGGAGGCCAGCAGCGGG - Intronic
1148129842 17:45256173-45256195 GGGGGCGGGGGGAAGACAGCAGG - Intronic
1148138605 17:45312000-45312022 GGGGGCAGGAGGTAAACAGGAGG - Intronic
1148153294 17:45409120-45409142 GAGGGCAGGATGGAAGCAGCGGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148892832 17:50820235-50820257 GTCAGCAGAAGGAAAACAGGAGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150952953 17:69822735-69822757 GTGGGCAGAACGAACCCAGCAGG + Intergenic
1151391025 17:73786699-73786721 GTGGGTAGGATGACAGCAGCAGG + Intergenic
1151499517 17:74480060-74480082 ATGGGAAGGAGAAAAAGAGCTGG - Intronic
1152266262 17:79296792-79296814 GTGGGGAGGAGGAAAAGAGGAGG - Intronic
1152968317 18:137418-137440 GTGCGTGGGAGGGAAACAGCAGG - Intergenic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1154334040 18:13452020-13452042 GGTGGCAGGAGGAAATCACCCGG + Intronic
1154498392 18:14979261-14979283 GTGGGAAGGAAGATCACAGCTGG + Intergenic
1155798603 18:30072572-30072594 CTGAGCAGGAGGAAAAGAGTGGG - Intergenic
1158774235 18:60556627-60556649 GTGGGCAGAAGGAGCCCAGCAGG + Intergenic
1158866323 18:61640942-61640964 GTGGGCAGGAGGGAAACCACTGG - Intergenic
1158866657 18:61644113-61644135 GTGGGCAGGAGGAAAACCACTGG - Intergenic
1159265000 18:66069292-66069314 CTGGGAAGGCAGAAAACAGCAGG + Intergenic
1159957186 18:74527093-74527115 GTGGGAAGGAGGAAAAGAGAGGG + Intergenic
1160143752 18:76347977-76347999 GGGGGCAGGAAGAGGACAGCCGG - Intergenic
1160262700 18:77309950-77309972 GAGGGCAGGAAGAACCCAGCAGG - Intergenic
1161403805 19:4080948-4080970 GAGGGCAGGAGGAAAGGAGAGGG + Intergenic
1161566662 19:5006309-5006331 GTGGGCTGCGGGGAAACAGCAGG - Intronic
1162558781 19:11403714-11403736 GTAGGGAGGAGATAAACAGCAGG + Intronic
1162908504 19:13837066-13837088 GAGGGCAGGAGGAAACCACCAGG + Intergenic
1163992243 19:21009370-21009392 ATGGGCAGTAGGAAAAAAGATGG - Intergenic
1164513902 19:28918151-28918173 GTGGGCAGGAGGAACAGCGCTGG + Intergenic
1164950250 19:32330982-32331004 GGGAGCAGGAGGAAGAGAGCAGG + Intergenic
1165007175 19:32816808-32816830 CCAGCCAGGAGGAAAACAGCAGG + Intronic
1165434294 19:35787990-35788012 GTGGTCAGGGGGAAAGCAGGAGG - Exonic
1165434331 19:35788119-35788141 GTGGGCAGGAGGGGAAGAGGAGG - Exonic
1165488817 19:36111459-36111481 GCAGGCAGGAGCGAAACAGCTGG - Intronic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
1166561354 19:43734339-43734361 GTGGGCAGGAGGAAAAATGAGGG - Intronic
1167050089 19:47072598-47072620 GTGGGCAGGAGGCCCACACCAGG + Exonic
1167259625 19:48451030-48451052 CTGAGCAGGAGGCAAACACCTGG - Exonic
1167903701 19:52640971-52640993 GCGGGCAAGAGGATGACAGCAGG + Intronic
1168294293 19:55371085-55371107 GAGAGCGGGAGGAAGACAGCAGG + Intergenic
925323502 2:2996712-2996734 GGGGGCTTCAGGAAAACAGCTGG + Intergenic
926347589 2:11962581-11962603 GTTGGCAGGAGGAAAAAGGGAGG - Intergenic
926406889 2:12562825-12562847 GGAGGCAGGAGGAAAACTGATGG + Intergenic
926980561 2:18562580-18562602 GAGGGTAGGAGGAAAAGAGGAGG + Intronic
928340566 2:30439788-30439810 GTGGGGAGGAGGAAAACGGAGGG - Intergenic
929489360 2:42382669-42382691 GTGGGCAGTCAGAGAACAGCTGG - Intronic
929855907 2:45638577-45638599 GTGTGCAGGAGGAATCCATCTGG - Intergenic
930105390 2:47635108-47635130 GTGGGCAGGAGGACAACAGGAGG - Intergenic
930113316 2:47697404-47697426 GTGGGCAGGACGAACCCATCAGG + Intronic
931400119 2:61924277-61924299 GTGGACAGGAGAAAAATAGGAGG + Intronic
932466644 2:71928431-71928453 TTGGGCAGCTGGCAAACAGCTGG - Intergenic
932529668 2:72515543-72515565 ATGGGAAGCAGGAAAAAAGCAGG + Intronic
932972197 2:76557732-76557754 GTGGGCAGGAGGTTTACAGCTGG + Intergenic
933766050 2:85710486-85710508 GGAGGCAGGAGGAAAACCCCAGG - Intergenic
934473443 2:94576706-94576728 GCGGGGAGGAGGAAACCACCAGG + Intergenic
934987094 2:98895437-98895459 GTGGGAAGGAGGGAAAGAACAGG + Intronic
935959864 2:108414278-108414300 GTGGGCATGAGGGAAAGAGAGGG - Intergenic
937126825 2:119480337-119480359 GTGGGCAGGAGGACACATGCAGG + Intronic
938291832 2:130154696-130154718 GTCTGCAGGAGGTAAACAACAGG + Intronic
938464716 2:131518268-131518290 GTCTGCAGGAGGTAAACAACAGG - Intergenic
938818903 2:134933481-134933503 GTGGGCAGGAGGAGAAAAAATGG + Intronic
939265873 2:139872144-139872166 AAGGGCAAGAGGAAAACGGCGGG - Intergenic
940285108 2:152026248-152026270 GAGGGAAGGAGGAAAATTGCTGG - Intronic
940369407 2:152883831-152883853 GTGGGCAGGGGGAGAACCCCTGG + Intergenic
940404900 2:153289747-153289769 GTGGGAAGGAGCTAAACTGCAGG + Intergenic
941733832 2:168949947-168949969 GAGGGCAGGAAGAATACAGCAGG - Intronic
942068247 2:172291940-172291962 GAGTGCAGGAGGAAAAGAGAGGG - Intergenic
942069002 2:172298470-172298492 GTGGGCAAGTAGAAAACAGAAGG - Intergenic
942552710 2:177135965-177135987 GTGGGCAGTATGAAAACAGGTGG - Intergenic
942845659 2:180421638-180421660 GTGGGCAAGAAGAACAAAGCTGG - Intergenic
944902299 2:204228040-204228062 TTGGGTAGGAGAAAATCAGCTGG + Intergenic
946159353 2:217826662-217826684 GAGGGAAGGAGGAAAACAGCAGG - Intronic
947820099 2:233063368-233063390 GTGGGCAAGGGGACAACGGCCGG + Intronic
947956642 2:234197692-234197714 GGAGACAGGAGGAAAACAGGAGG + Intergenic
948031908 2:234825398-234825420 TTTGGAAAGAGGAAAACAGCTGG - Intergenic
948202937 2:236142807-236142829 GTTGCCAGGTGGAAAGCAGCTGG + Intergenic
948425997 2:237886868-237886890 GTGGGCAGGTGGAACACGTCTGG + Intronic
948556253 2:238813519-238813541 GTGGGGAAGGGGAAAGCAGCAGG - Intergenic
948556306 2:238813767-238813789 GCTGGAAGGAGGAGAACAGCAGG - Intergenic
948581872 2:238992821-238992843 GTGGGCATGCTGGAAACAGCAGG - Intergenic
1168984005 20:2032068-2032090 GTGAGCAGCAGGGAAACAGCAGG - Intergenic
1170413206 20:16112748-16112770 GTGGGCTGAATGAAACCAGCAGG - Intergenic
1170787882 20:19483217-19483239 GTGGGTAGGAGGAAAACTATTGG - Intronic
1170851012 20:20004507-20004529 GGAGGGAGGAGGAAAACATCTGG + Intergenic
1171182001 20:23097925-23097947 GTGGGCAGATGGAAAGCAGTGGG - Intergenic
1172166037 20:32899976-32899998 AGGGGCCGGAGGAAAACTGCAGG - Intronic
1172607015 20:36220821-36220843 GTGGCCAGGAGGAAGGCAGGAGG + Intronic
1173371665 20:42441946-42441968 CTAGGCAGGAGGAAATCAGCTGG - Intronic
1173860075 20:46277622-46277644 GTGGGGTGGAGGAAATCAGAGGG + Intronic
1174438144 20:50526709-50526731 GGGGGGAGGAGAGAAACAGCTGG - Intronic
1174589090 20:51630967-51630989 TTGGGCGGCAGGAAAACAGGTGG - Intronic
1175181233 20:57149068-57149090 ATGGGCTGGGGGACAACAGCAGG + Intergenic
1175467307 20:59198084-59198106 GTGGGCACCAGGCACACAGCAGG - Intronic
1176511117 21:7748876-7748898 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1176517808 21:7799330-7799352 GTGGGCAGGAGAACTGCAGCTGG - Intergenic
1178645231 21:34379405-34379427 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1178651836 21:34429343-34429365 GTGGGCAGGAGAACTGCAGCTGG - Intergenic
1179128325 21:38611918-38611940 CTGGGCAGGAGGAAAAAAAGCGG + Intronic
1180059741 21:45378748-45378770 GAGGGCAGGGGGAGAACTGCGGG - Intergenic
1180092436 21:45539961-45539983 AGGGCCAGGATGAAAACAGCCGG + Intronic
1180975479 22:19845586-19845608 GAGGCCAGGAGGAAAGGAGCCGG + Intronic
1181372662 22:22430671-22430693 TGGGGATGGAGGAAAACAGCTGG - Intergenic
1182297143 22:29316275-29316297 GTGGGCAGGAGGAAGGTAGGAGG - Intronic
1182362717 22:29756459-29756481 GAGGGCAGGAGGCAAACACAGGG - Intronic
1182475732 22:30575336-30575358 GTGGGCAGTAAGGAACCAGCTGG + Intergenic
1182615441 22:31585915-31585937 GTGGGCAGCACGAAAATAACTGG - Intronic
1182756910 22:32687719-32687741 GAAGCGAGGAGGAAAACAGCAGG - Intronic
1183209175 22:36439990-36440012 GCCGGCAGATGGAAAACAGCTGG - Intergenic
1183390306 22:37541952-37541974 GTGGGGAGGAGGAAAGCAGAGGG - Intergenic
1183441245 22:37824369-37824391 GTGGGCAGTTAGAAAATAGCTGG - Intronic
1183474045 22:38026251-38026273 CTGGGCAGGAGGGAAAGAGAGGG - Intronic
1185189562 22:49426245-49426267 GGGTGCAGGAGGAACACAGACGG - Intronic
949422538 3:3881400-3881422 GTGGGGAAGAGAAAAACAGAAGG - Intronic
949661285 3:6282093-6282115 GTGGGTTGGAGGCAAGCAGCAGG + Intergenic
950195349 3:11005610-11005632 GTGATGAGGAGGAAAACAGGAGG - Intronic
951342330 3:21503604-21503626 CTGGGCCTGAGGTAAACAGCTGG + Intronic
952107914 3:30090632-30090654 GTCGGCTGAAGGAAGACAGCAGG - Intergenic
953380978 3:42472901-42472923 GAGGGCAGGGGGAAAAGAGAAGG - Intergenic
953552970 3:43918683-43918705 CTGGGCAGGAGGAAAAACGAAGG - Intergenic
953801959 3:46031325-46031347 GTGGGGAGAAGCCAAACAGCAGG - Intergenic
953974497 3:47371797-47371819 GTGGGGAGGAGGATAAGAGAAGG - Intergenic
956640322 3:71409480-71409502 GTAGGCAGGAGGCAAGAAGCAGG + Intronic
959868870 3:111303527-111303549 GTGTGCAGGATGAAAGCCGCAGG + Intronic
960324934 3:116284083-116284105 GTGGTCAGGAGGAGAAGACCAGG + Intronic
960593591 3:119388610-119388632 GTGGGAAGGAGGAAAGTGGCTGG + Intronic
961197529 3:125015325-125015347 GTGGTGAGGAGGTAAACAGTTGG + Intronic
961235401 3:125362071-125362093 GTGGGCATGGAGAAAACAGATGG - Intronic
963882711 3:150546356-150546378 GTGCGCAGGAGGAAGAGAACTGG + Exonic
963939820 3:151086773-151086795 GCAGGCAGGAGGAATAAAGCAGG - Intronic
964563949 3:158029290-158029312 TTGGGCAGGAGGCAGCCAGCAGG + Intergenic
965453277 3:168865310-168865332 GGGGGGAGGGGGAAACCAGCAGG - Intergenic
965694100 3:171389208-171389230 CTGGGCAGTAGGAAAAAAGATGG - Intronic
965840124 3:172895261-172895283 GGGACCAGGAGGAAAACAGATGG - Intronic
965924166 3:173957820-173957842 GTGGGCAGAAGGAGCCCAGCAGG - Intronic
966935950 3:184709546-184709568 GGTGGCAGGTGGAAAGCAGCAGG + Intergenic
968080018 3:195839589-195839611 GAGGGGAGGAGGGAGACAGCTGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968163522 3:196446138-196446160 GTGGGCAGGAAGAATCCATCAGG + Intergenic
968300837 3:197613262-197613284 GTGGGCAGGAAGAACCCATCGGG - Intergenic
968962454 4:3752541-3752563 GTGTGCGGCAGGAACACAGCCGG + Intergenic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
969385551 4:6844377-6844399 GTGGGGGAGAAGAAAACAGCTGG - Intronic
969526589 4:7706941-7706963 GTGGTGAGCAGGAAAGCAGCAGG - Intronic
969978197 4:11126616-11126638 GGGGGAAGGAGGAGAACACCTGG + Intergenic
970733658 4:19139946-19139968 TTGAGCAGGAAGAAAAAAGCTGG + Intergenic
971261685 4:25062994-25063016 GAGGGCAGTTGGAAAACGGCTGG + Intergenic
971769591 4:30879151-30879173 GAGGGAGGGAGGAAAACAGGAGG - Intronic
971834588 4:31747659-31747681 GTGGGCAGAAGGAGTCCAGCAGG - Intergenic
971855452 4:32036992-32037014 GTGGGTAGGAAGAAATCACCAGG + Intergenic
971949377 4:33324928-33324950 ATGGGCAGGAGGATAAAATCAGG + Intergenic
971971506 4:33626383-33626405 GCAGGCAGGAGAAAAACATCAGG + Intergenic
972712536 4:41612109-41612131 GTGGGCAAGAGGACAAGGGCAGG - Intronic
972768187 4:42171244-42171266 GAAGGCAGGAGGAGAAAAGCAGG - Intergenic
973664351 4:53141902-53141924 GTGGGCAGCATCCAAACAGCTGG - Intronic
974806474 4:66887087-66887109 GGGGGCTGGAGGAGAACAGATGG - Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976188656 4:82468315-82468337 GTGGGCAAGAAGAACCCAGCTGG - Intergenic
976746529 4:88408712-88408734 GTGGGCAGGAAGAACTCATCGGG - Intronic
977359237 4:95982026-95982048 GTGGGCAGAATGAACCCAGCAGG + Intergenic
979213739 4:118137742-118137764 ATGGGCAATAGGAAAACAGGTGG + Intronic
979239352 4:118434761-118434783 CAGGGAAGGAGGGAAACAGCAGG + Intergenic
979244267 4:118481627-118481649 ATGGGCATGAAGAAAACTGCTGG - Intergenic
980814411 4:137924443-137924465 GTGAGCAGGAAGAGAAGAGCTGG - Intergenic
980897993 4:138877901-138877923 ATGGGCAGAAGCAAAACAACAGG + Intergenic
981219902 4:142219770-142219792 GTAGGTAGAAGGAAAACACCAGG + Intronic
981949255 4:150386397-150386419 GTGGGAGGAAGGAAAACATCAGG - Intronic
983666398 4:170189108-170189130 TTGGGAAGGAGGAAGACAGAAGG + Intergenic
984660917 4:182374292-182374314 GTGGCCAAGAAAAAAACAGCAGG - Intronic
985268822 4:188175548-188175570 GGAGGCAGGAGGAACACAGGAGG + Intergenic
985563082 5:601786-601808 GGGGGCAGGAGGATCCCAGCGGG + Intergenic
985829220 5:2215632-2215654 GTGGGCAGGTGGGAAGCGGCAGG + Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987083406 5:14446491-14446513 GTGGGCAGGGGGAAGAGAGGGGG + Intronic
987329772 5:16846391-16846413 GTGGGAAGGAGGAAGAAAACAGG - Intronic
987675274 5:21065044-21065066 GTTGGCAGGAGAACACCAGCAGG + Intergenic
988783781 5:34547238-34547260 GTGGGCAGGAAGAACCCATCAGG + Intergenic
989774081 5:45181960-45181982 GAGGGCAGGAGGAAAAGATAAGG - Intergenic
990365796 5:55069150-55069172 GTGGCCATGAGGAAAAGAGGTGG + Intergenic
990508027 5:56464170-56464192 GTGGTCAGGAGGCAGAAAGCAGG + Intronic
990521005 5:56580921-56580943 ACAGGCAGGAGGAAATCAGCTGG + Intronic
990934834 5:61136883-61136905 ATGGGCAGGATGAAAATACCAGG - Intronic
991508806 5:67354067-67354089 GTGGGAGGCAGGAAAACAGAAGG - Intergenic
991609980 5:68440030-68440052 GTGGGCAGGAAGAAACCACTGGG - Intergenic
993537273 5:89102534-89102556 GTGGTCATGAGGAAGACTGCTGG + Intergenic
993540037 5:89137944-89137966 GTGGGCAGGAGGATTACAGCTGG + Intergenic
993941779 5:94067869-94067891 GTGAGCAAAAGGAACACAGCTGG + Intronic
994913866 5:105947344-105947366 GTGAGCAGCAGCAAAACAGTTGG + Intergenic
994924393 5:106095865-106095887 GTGGACAGAAGGAAAGCAGCGGG + Intergenic
995226617 5:109708144-109708166 GTTGGCAGGAGGAAAACCTAGGG + Intronic
996323663 5:122248227-122248249 CTGGGCAAGAAGAACACAGCTGG - Intergenic
996329246 5:122311676-122311698 GGGGGCAGGAGGAGAAAAGTGGG + Intronic
997962839 5:138335595-138335617 GGGGGCAGCAGGGAAAGAGCAGG + Intronic
998894037 5:146778990-146779012 TGGGGCAGGACGAACACAGCTGG + Intronic
1001112620 5:168910070-168910092 GTGGGCAGGACCAAACCATCTGG + Intronic
1001311269 5:170612669-170612691 GGTGGCAGGAGGAGAACAGACGG + Intronic
1001742820 5:174067946-174067968 GTGGGGAGGGGGAAGACAGGTGG + Intronic
1002739595 5:181425341-181425363 CAGGGAAGGAGGGAAACAGCAGG + Intergenic
1003390364 6:5708065-5708087 GTGGGTAGGATGAAAACATGTGG + Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004427123 6:15514041-15514063 GTGGGCACGAGGAAGCCAGCAGG - Intronic
1004466429 6:15889552-15889574 TTTGGCAAGAGGAAAAGAGCAGG - Intergenic
1005077847 6:21926081-21926103 TTTGGAAGGAGGAAAACAGGAGG - Intergenic
1005316254 6:24605452-24605474 GTGGGCAAAAGGCAAGCAGCAGG - Intronic
1006374351 6:33663636-33663658 GTGGGCTGGAGGGAGACAGATGG + Intronic
1006905203 6:37528588-37528610 GTGGGCTGGGGGAGAGCAGCAGG - Intergenic
1007230715 6:40345891-40345913 ATGGGGAGGAGGCACACAGCCGG - Intergenic
1007262739 6:40575240-40575262 GTGGGCAGCAGGGGAAGAGCTGG - Intronic
1007902281 6:45423007-45423029 GTGGGCAGGAAGACACCGGCGGG - Intronic
1008006094 6:46410920-46410942 GTGGGCAGCAGGGAAAGAACAGG + Intronic
1009988740 6:70814616-70814638 GTAGGCAGGACGAAATCAGATGG - Intronic
1010521685 6:76845929-76845951 CTGGGCAAGAGGAACAAAGCTGG - Intergenic
1012612930 6:101237567-101237589 ATGAGGAGGAGGAAAACAGCTGG + Intergenic
1013419069 6:109949800-109949822 ATGGGCAGGAGGAGGACTGCAGG + Intergenic
1013581277 6:111536944-111536966 TAGGGCAGGAAGAAATCAGCCGG - Intergenic
1013582428 6:111549583-111549605 GTGGGAAGGAGGAAGTGAGCAGG + Intergenic
1014139521 6:117925430-117925452 GTGGACAGAAGGAAACTAGCTGG + Intronic
1014424960 6:121292856-121292878 CTGGGCAGGAGCAAAGCAGAAGG + Intronic
1014781938 6:125574661-125574683 GTGGACAGACGGCAAACAGCGGG + Intergenic
1015323077 6:131897803-131897825 GTGGGCAGGAAGAACCCATCAGG - Intergenic
1015370478 6:132445774-132445796 GAGGGCACCAGCAAAACAGCAGG + Intergenic
1016375820 6:143419544-143419566 ATGGGCTGGAGGAAAACATCTGG + Intergenic
1016908449 6:149173883-149173905 GGAGGCAGGAGGAAAAGAGAAGG + Intergenic
1017123541 6:151045682-151045704 GAGGGGAGGAGGAAACCACCAGG - Intronic
1017600288 6:156073023-156073045 GTGGGCAGGAGACAAAAATCTGG + Intergenic
1017764025 6:157592691-157592713 GGGGGAAGGAGGAAAAGGGCGGG + Intronic
1018324597 6:162651675-162651697 ATGGGAAGAAGGAAAAAAGCAGG + Intronic
1018639080 6:165890245-165890267 GTGGGAAAGAGAGAAACAGCAGG - Intronic
1019212247 6:170416150-170416172 TTGGAAAGGTGGAAAACAGCAGG + Intergenic
1019244711 6:170700928-170700950 CAGGGAAGGAGGGAAACAGCAGG + Intergenic
1019340596 7:507179-507201 GAGGGTTGGAGGAAAACATCCGG - Intronic
1019722004 7:2578294-2578316 GCCTGGAGGAGGAAAACAGCAGG + Exonic
1019775462 7:2909702-2909724 CTGGGCAGCAGGGGAACAGCTGG - Intronic
1020002612 7:4764410-4764432 GGGGGCAGGATGAACACAGCCGG + Exonic
1021738768 7:23664408-23664430 GTGGGCAGGAAGAACCCATCAGG - Intergenic
1023256826 7:38320642-38320664 GGGGGCAGAAGGAATACAGATGG - Intergenic
1023292610 7:38684124-38684146 TTGGGAAGGAGGAGAAAAGCAGG - Intergenic
1024936835 7:54719490-54719512 GTGGCCAGGAGGAAATCAGTTGG - Intergenic
1025078395 7:55962847-55962869 GAGGGCAGGAGGAAGGAAGCTGG - Intronic
1025961727 7:66228847-66228869 GGGGGAAGGAGGAAGACAGATGG - Intronic
1026388939 7:69880153-69880175 CTGGGCAGGAGGAAGAAAGTGGG + Intronic
1026735639 7:72946842-72946864 CTTGGCAGGAAGAAAACGGCAGG - Intronic
1026816462 7:73516310-73516332 GTGGGAAAAAAGAAAACAGCTGG - Intronic
1026897987 7:74021621-74021643 GTGGGCAGGAGGACAAAGGCTGG + Intergenic
1026993555 7:74601425-74601447 GTGGGCAGGTGGACCTCAGCCGG - Intronic
1027108082 7:75418169-75418191 CTTGGCAGGAAGAAAACGGCAGG + Exonic
1027216745 7:76188647-76188669 GTGGGCAGGAAGAACCCATCGGG - Intergenic
1027439281 7:78200857-78200879 GTGGACAGGAGAAAAACAAAAGG + Intronic
1029250435 7:99232606-99232628 GTGGGCAGAAATAGAACAGCTGG - Intergenic
1030060221 7:105615739-105615761 GTGGACAGGAGGAGAAAAACAGG + Intronic
1030065519 7:105656072-105656094 GTGGGCAGGAGGCAGAGAGGAGG - Intronic
1030280105 7:107765133-107765155 GTGGGAAGAAGAAAAACAGATGG - Intergenic
1032000340 7:128261076-128261098 GTGGGCAAGCAGAAAACGGCTGG - Intergenic
1032010932 7:128347485-128347507 GTGGGCAGGAGGGAAGGAGAAGG - Intergenic
1033088383 7:138363105-138363127 GTGGGAAGGGGGAAAAAAGGTGG - Intergenic
1034263321 7:149770379-149770401 GAGGGCAGGAGGAAAGCAGGGGG + Intronic
1034265864 7:149780388-149780410 GTGGGCAGCAGGCACACAGAGGG - Intergenic
1034272722 7:149811196-149811218 GTGGGGAGAGGGAAAACAGGTGG - Intergenic
1034437628 7:151070685-151070707 GTGGGCAAGAGCAGAGCAGCAGG - Intronic
1034585541 7:152088958-152088980 GTGGGCAGGAAGAACCCATCGGG - Intronic
1034755856 7:153618718-153618740 GATGGCAGGAGGAGAACATCAGG - Intergenic
1034839913 7:154386283-154386305 GGGGGCAGGAGGAACACAAACGG - Intronic
1034989447 7:155538787-155538809 GTGGGCAGGAGGTGAATAGGAGG - Intergenic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035398686 7:158551230-158551252 GTGGGAAGGAGGAGGGCAGCCGG + Intronic
1035503415 8:107260-107282 CAGGGAAGGAGGGAAACAGCAGG - Intergenic
1035902967 8:3477892-3477914 CAGGGCAGGTGGAAAAGAGCAGG + Intronic
1036712841 8:11092931-11092953 GTGGGCAGGAGGCCCTCAGCGGG - Intronic
1037662585 8:20940444-20940466 GTGGGCAAGAGGAAAAAGGTGGG - Intergenic
1037987030 8:23296446-23296468 GTGGGCAGGTGCTACACAGCAGG - Intergenic
1038338564 8:26664713-26664735 GTGAGCAGGGGGAACACAGAGGG - Intergenic
1038922500 8:32100112-32100134 GAGGGAAGGAGGAAAAGAGGGGG - Intronic
1039407857 8:37328272-37328294 GGGGGCAGGAGGAGAGGAGCGGG - Intergenic
1040286685 8:46104021-46104043 GTGGGCAGGAGAAACGCAGGAGG - Intergenic
1041868006 8:62598862-62598884 GTGAGCAGGTGGACAACAGCTGG - Intronic
1042572308 8:70178783-70178805 GTGGACAGCAAGAAAACAGGTGG + Intronic
1045391843 8:101723002-101723024 GTGGTGAGGAGGAAGACAGAGGG + Intronic
1046128319 8:109938775-109938797 GAGGGCAGGAAGAATCCAGCAGG + Intergenic
1047469909 8:125160375-125160397 GTGGGCAGCAGGAAACCATCGGG + Intronic
1047583827 8:126246967-126246989 GTGGGAAGGGGGAAAAGAGCTGG - Intergenic
1048010155 8:130448867-130448889 GTGGGCAGGAGGGAGGCAGAGGG + Intergenic
1048988712 8:139748963-139748985 GTGTGCAGCAGGGAGACAGCAGG + Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049305802 8:141903201-141903223 GTAGGCAGGAGACAAACTGCTGG + Intergenic
1050223739 9:3426522-3426544 GTGAGCAGGAGGTGAGCAGCAGG + Intronic
1050435769 9:5608749-5608771 GTGGTCAGGAGGTAGAGAGCAGG + Intergenic
1051747567 9:20309356-20309378 GTAGGCAGAGGGAAAACAGCTGG + Intergenic
1053615786 9:39764693-39764715 TTGGGCAAAAGGAAAAAAGCTGG + Intergenic
1053684891 9:40511796-40511818 GCGGGGAGGAGGAAACCACCAGG - Intergenic
1053873956 9:42523986-42524008 TTGGGCAAAAGGAAAAAAGCTGG + Intergenic
1053898666 9:42770586-42770608 TTGGGCAAAAGGAAAAAAGCTGG - Intergenic
1053934852 9:43140079-43140101 GCGGGGAGGAGGAAACCACCAGG - Intergenic
1054237734 9:62577698-62577720 TTGGGCAAAAGGAAAAAAGCTGG - Intergenic
1054268377 9:62942770-62942792 TTGGGCAAAAGGAAAAAAGCTGG - Intergenic
1054278836 9:63113160-63113182 GCGGGGAGGAGGAAACCACCAGG + Intergenic
1054297982 9:63347259-63347281 GCGGGGAGGAGGAAACCACCAGG - Intergenic
1054396000 9:64651777-64651799 GCGGGGAGGAGGAAACCACCAGG - Intergenic
1054499736 9:65864549-65864571 GCGGGGAGGAGGAAACCACCAGG + Intergenic
1054551866 9:66612205-66612227 TTGGGCAAAAGGAAAAAAGCTGG - Intergenic
1054809498 9:69423797-69423819 GTGGGCAGGAGGAGGGCAGTTGG - Intergenic
1055578183 9:77680687-77680709 GTGGGAAGGAGGAAAAAAAACGG - Intergenic
1055686641 9:78782128-78782150 GTGGGCAGGAAGAACTCATCAGG + Intergenic
1056658640 9:88528911-88528933 GTTGGCAGATGGAAAACAGAGGG + Intergenic
1057073842 9:92123914-92123936 GGGGGCAGTAGGAAAACCGGGGG + Intergenic
1057568331 9:96184490-96184512 GTTTGCAGGTGGAAAAGAGCAGG + Intergenic
1058636683 9:107044803-107044825 ATGCTCAGGAAGAAAACAGCAGG + Intergenic
1058704594 9:107627938-107627960 GAGGGCAGGAGGGAAACACATGG + Intergenic
1059662520 9:116416045-116416067 TTAGGCAGAAGGAAAAAAGCTGG + Intergenic
1060265344 9:122108778-122108800 GCCGGCAAGAGGAACACAGCTGG + Intergenic
1060968566 9:127724947-127724969 GCGGGCAGGAGGCCAACTGCTGG + Intronic
1060969981 9:127732348-127732370 AGGGGCAGGAGGAAAAATGCTGG + Intronic
1061149781 9:128822115-128822137 TTGGGCATAAGGAAAACAGAGGG + Exonic
1061498390 9:130988919-130988941 GGGGGCAGGAGGGAGACAGAGGG + Intergenic
1061547541 9:131313420-131313442 GTGGGAAGGAAGAAACCAGGTGG - Intergenic
1061804019 9:133128249-133128271 GTGAGCCGGAGGACCACAGCGGG + Intronic
1203604901 Un_KI270748v1:50148-50170 CAGGGAAGGAGGGAAACAGCAGG + Intergenic
1186091056 X:6049267-6049289 GAGGGGAGGAAAAAAACAGCAGG + Intronic
1186181929 X:6982221-6982243 GTTGGCAGGAGGAACACATTAGG - Intergenic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186472601 X:9833071-9833093 TTGTGGAGAAGGAAAACAGCAGG + Intronic
1186891855 X:13966847-13966869 GAGGGCAAGAGGCAAACATCGGG + Intergenic
1187084819 X:16031028-16031050 GTGGGAATGAGGAAAATAGAGGG + Intergenic
1187112842 X:16319046-16319068 GTGGGCAGGAAGAACTCATCAGG + Intergenic
1187988951 X:24848798-24848820 GTGGGCAGGAGGGATAGAGTGGG - Intronic
1189070874 X:37862496-37862518 CTGGGCAGGGGGAAATAAGCAGG + Intronic
1190234461 X:48605045-48605067 GTGGGATGGAGGACAGCAGCAGG - Exonic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1190592256 X:52016078-52016100 GTGGGCAGGAGGAAAAGGAAGGG - Intergenic
1191824587 X:65351022-65351044 CTGGGCAAGAAGAAAAAAGCTGG + Intergenic
1192200414 X:69062977-69062999 GTGGCCAGGGTGAAAAGAGCAGG - Intergenic
1192458509 X:71297832-71297854 GTAGGCAGGAGGAAGAGCGCAGG + Exonic
1192469178 X:71381978-71382000 ACGGGCAGGAGGAAATCAGAAGG + Intronic
1193876551 X:86869005-86869027 TTGGGCAGGAGGAGTACTGCCGG + Intergenic
1197663071 X:129194597-129194619 GTGGGCAGGAAGAACCCATCAGG - Intergenic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1199493985 X:148432756-148432778 GTTGGCAGGAGGAAATCAGTGGG - Intergenic
1200055426 X:153457526-153457548 GTGGGCAGGCAGCACACAGCAGG + Intronic
1201479823 Y:14427601-14427623 GTGGGCAGTGGGGAAAGAGCAGG + Intergenic
1202104506 Y:21348698-21348720 GTGGGCACCAGTAAAACAGTAGG - Intergenic
1202387086 Y:24336544-24336566 CAGGGAAGGAGGGAAACAGCAGG + Intergenic
1202483700 Y:25333584-25333606 CAGGGAAGGAGGGAAACAGCAGG - Intergenic