ID: 986732554

View in Genome Browser
Species Human (GRCh38)
Location 5:10645906-10645928
Sequence ACCAAAAATGTCTACAGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 2, 2: 31, 3: 82, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986732554_986732560 29 Left 986732554 5:10645906-10645928 CCACGTCTGTAGACATTTTTGGT 0: 1
1: 2
2: 31
3: 82
4: 223
Right 986732560 5:10645958-10645980 CTAGAAGAAGGTAGAGATCAGGG 0: 1
1: 0
2: 0
3: 23
4: 325
986732554_986732558 17 Left 986732554 5:10645906-10645928 CCACGTCTGTAGACATTTTTGGT 0: 1
1: 2
2: 31
3: 82
4: 223
Right 986732558 5:10645946-10645968 TGCTACTGGCATCTAGAAGAAGG 0: 1
1: 0
2: 27
3: 126
4: 396
986732554_986732559 28 Left 986732554 5:10645906-10645928 CCACGTCTGTAGACATTTTTGGT 0: 1
1: 2
2: 31
3: 82
4: 223
Right 986732559 5:10645957-10645979 TCTAGAAGAAGGTAGAGATCAGG 0: 1
1: 0
2: 0
3: 19
4: 290
986732554_986732556 -8 Left 986732554 5:10645906-10645928 CCACGTCTGTAGACATTTTTGGT 0: 1
1: 2
2: 31
3: 82
4: 223
Right 986732556 5:10645921-10645943 TTTTTGGTTGTCAGAACTGGCGG 0: 1
1: 57
2: 271
3: 587
4: 1045
986732554_986732557 3 Left 986732554 5:10645906-10645928 CCACGTCTGTAGACATTTTTGGT 0: 1
1: 2
2: 31
3: 82
4: 223
Right 986732557 5:10645932-10645954 CAGAACTGGCGGACTGCTACTGG 0: 1
1: 0
2: 0
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986732554 Original CRISPR ACCAAAAATGTCTACAGACG TGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903710647 1:25321358-25321380 AAAAAAAATGTCTACAGAATCGG + Intronic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
1063252926 10:4293964-4293986 ACCAAAAGTGTGCAAAGACGTGG - Intergenic
1063770053 10:9186751-9186773 AGAAAAAATGTCTACATACTTGG - Intergenic
1065322061 10:24519372-24519394 AATAAAAATGACGACAGACGTGG - Intronic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1072346446 10:94512169-94512191 AACTAAAATATCTACAGAGGAGG - Intronic
1072671427 10:97432612-97432634 ACTCAAGATGTCTACAGATGTGG - Exonic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1073633200 10:105169608-105169630 ACCAAAAATGTAAATAGAGGTGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079878836 11:25897395-25897417 TCCAAAAATTCCTACAGAAGCGG - Intergenic
1080322799 11:31033843-31033865 AGTAAAAATGTCTACAGGCCGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082933419 11:58632457-58632479 ACCAACAATGCCTACAGAACAGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083821645 11:65174925-65174947 ACTCAAGATGTCTACAGATGGGG + Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084568057 11:69942810-69942832 ATCAAAAATGTACACAAACGTGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086223680 11:84481582-84481604 ACCCACAATGTCTTCAGAAGTGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086836668 11:91632650-91632672 ACCAAAAATGAATAAAGACCTGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092502890 12:9065310-9065332 ACAGAAAATGTCCACAGCCGCGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095969290 12:47890837-47890859 ACTCAAGATGTCTACAGATGTGG + Intronic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1100336961 12:93640712-93640734 ACTCAAGATGTCTACAGATGTGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101300897 12:103479617-103479639 ACCAAAAACTTCTACAAACTAGG - Intronic
1101361501 12:104031631-104031653 ACTCAAGATGTCTACAGATGTGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1104308625 12:127633875-127633897 ACCCAAAATGTTTACCCACGTGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1106951622 13:34890822-34890844 CTAAAAAATGTCTACAGACTGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109556116 13:63977591-63977613 TTCTAAAATGTCTACAGATGTGG - Intergenic
1110039504 13:70735159-70735181 ACATAAAATATCTACACACGTGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120258704 14:82154808-82154830 ACCTAAAATTTCTACAGAGCAGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132874898 16:2132660-2132682 ACCAAAAATGTGAACACACCAGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133397877 16:5462766-5462788 ACCAAAAAGGACTCCAGAAGAGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134520093 16:14914722-14914744 ACCAAAAATGTGAACACACCAGG - Intronic
1134553840 16:15151510-15151532 ACCAAAAATGTGAACACACCAGG + Intergenic
1134707767 16:16313376-16313398 ACCAAAAATGTGAACACACCAGG - Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1134959776 16:18398749-18398771 ACCAAAAATGTGAACACACCAGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1138782723 16:59808637-59808659 GCCAAAAAAGTCTACACATGAGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1146171839 17:30640525-30640547 ATCAACCACGTCTACAGACGTGG + Intergenic
1146345294 17:32056550-32056572 ATCAACCACGTCTACAGACGTGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148832768 17:50445497-50445519 ATCAAAAGTGTCTACAGGCTGGG + Intronic
1149052784 17:52326175-52326197 TCCAAAAATCTCTACAGCAGGGG + Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159966715 18:74602011-74602033 ACAAAAAATATATACAGATGTGG - Intronic
1160476896 18:79199408-79199430 ACTAAAAAAGACTACAGACTAGG - Intronic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164229108 19:23272465-23272487 ACGTAAAATGTTTACAGACTTGG + Intergenic
1164280556 19:23764738-23764760 ACATAAAATGTTTACAGACTTGG - Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168455135 19:56501110-56501132 AGCAAAAATGTCAAGAGAAGAGG - Intergenic
925386499 2:3465506-3465528 AGCACAAGTGTATACAGACGCGG - Intronic
927823759 2:26292658-26292680 ATCTAAGATGCCTACAGACGAGG + Intergenic
928227875 2:29469232-29469254 ACCCAACATGTCCACAGATGTGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937469496 2:122163121-122163143 ACCAAAAATGCCTACATTTGAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
939200621 2:139030291-139030313 GCCACAAATGTCTACAGTCCAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169798697 20:9493351-9493373 ACCAAAAGTGTCTACTGCAGTGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171256743 20:23694380-23694402 ACCAGAAATGTCCACAGGTGTGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173947874 20:46965832-46965854 CCCACAAAAGTCAACAGACGTGG - Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175868008 20:62191695-62191717 ACAAAAGATGTGTACAGAAGGGG - Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953156932 3:40384156-40384178 AGCAAAATTGTCTAGAGAAGTGG + Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953621897 3:44540353-44540375 AAAAAAAAAGTCTATAGACGGGG + Intergenic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
953989228 3:47471180-47471202 AGCAAAAATGAGTACAGAAGAGG + Intronic
954605417 3:51905617-51905639 TCCACAAATCTCTACAGAAGGGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957066683 3:75528551-75528573 TCCACAAATGTCTACAGCAGGGG + Intergenic
958827793 3:99052820-99052842 AAAAAAAATTTCTAGAGACGTGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969252118 4:5974804-5974826 AACATAAATGTCTAGATACGTGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978006349 4:103622019-103622041 GCCAAAAAAGTCTACTGAAGAGG + Intronic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978975917 4:114872201-114872223 ACTATAAATGTCTAAAGAGGAGG + Intronic
979981499 4:127261643-127261665 AACAAATCTGTCTACAGATGTGG - Intergenic
982899999 4:160986786-160986808 ACCAACAATGACAGCAGACGTGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987443895 5:17992429-17992451 ACCAAAAAGGCCTACACTCGAGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989178407 5:38553010-38553032 TCAAGAAATGTTTACAGACGTGG - Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990352226 5:54930358-54930380 CCAAAAAATGTCTACAGATTGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991947638 5:71915170-71915192 GCCAAAAATGTGAACAGAAGTGG + Intergenic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995530529 5:113087484-113087506 ACCAAAAATGGGTACAGGGGTGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005902297 6:30227359-30227381 ACCATAAATGTCTAGAGGCTAGG + Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010509402 6:76699825-76699847 AAAAAGAATGTCTACAGAAGTGG + Intergenic
1011749366 6:90439790-90439812 ACCAAAGATATCTACAGAAGAGG + Intergenic
1012064959 6:94538070-94538092 TCCAAAGATCTCTACAGATGGGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012446248 6:99310119-99310141 ACCAAAAAAGTCTACTGTCTAGG + Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014049572 6:116936303-116936325 ATCAAAATTTTCTACAGAAGAGG - Intergenic
1014464938 6:121743987-121744009 ACCAAAAATGTCCAGAGGAGAGG + Intergenic
1014497559 6:122144768-122144790 ACCAAAAATATTTTCAGAAGGGG - Intergenic
1014856680 6:126411274-126411296 GCCATAAATTTCTACAGCCGTGG - Intergenic
1015817752 6:137228237-137228259 ACCACAAATGACTACAGAATAGG - Intergenic
1016417721 6:143850679-143850701 AACACAAAAGTCTACAGAAGTGG + Intronic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020332307 7:7032238-7032260 ACTAAAAATATCTACAACCGAGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023080172 7:36519420-36519442 AACAAAAATGTTTTCAGAGGAGG - Intronic
1025279971 7:57619919-57619941 ACCAGAAATGCCTACAGTTGCGG - Intergenic
1025304763 7:57845582-57845604 ACCAGAAATGCCTACAGTTGCGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1029951717 7:104593455-104593477 TCCAAAAATGACCACAGACTTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032151316 7:129432625-129432647 ACCAAAAATGTCTCGGGGCGGGG - Intergenic
1032161918 7:129517358-129517380 AGAAAAAATGTCCACAGAGGAGG + Intergenic
1033644015 7:143287429-143287451 ACCAATTGTGTCTACAGAGGGGG + Exonic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1041267990 8:56083614-56083636 ATAACAAATGTCTACAGAGGAGG + Intergenic
1041415854 8:57608455-57608477 ACCAAAAAAGACTGCAGAGGAGG + Intergenic
1041710625 8:60891035-60891057 ACTAAAAATGCCCACAGATGGGG - Intergenic
1044194486 8:89358112-89358134 ATCAGAAATGTCTAAAGAAGAGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048053414 8:130841026-130841048 ACAAAAAACCCCTACAGACGTGG + Intronic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1053792245 9:41695029-41695051 ACCAAGAATGACTACAAATGCGG + Intergenic
1054180656 9:61907049-61907071 ACCAAGAATGACTACAAATGCGG + Intergenic
1054472700 9:65550937-65550959 ACCAAGAATGACTACAAATGCGG - Intergenic
1054656935 9:67674093-67674115 ACCAAGAATGACTACAAATGCGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057492186 9:95529015-95529037 AAAAAAAAAGTCTACAGAAGTGG + Intergenic
1059265662 9:113027580-113027602 ACCAGAAATGACTATAGAAGGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1193135680 X:77968764-77968786 ACTCAAGATGTCTACAGATGTGG + Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1196389624 X:115193686-115193708 ACCAAAAAGGTCCACAGTGGTGG - Intronic
1197246597 X:124173079-124173101 ACCAAAAATGTCATAACACGTGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200251151 X:154554597-154554619 ACAAAAATTAGCTACAGACGTGG + Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic