ID: 986734248

View in Genome Browser
Species Human (GRCh38)
Location 5:10656448-10656470
Sequence CAGATGAACTAAAGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986734248 Original CRISPR CAGATGAACTAAAGGGACAC TGG Intergenic
902359970 1:15937076-15937098 CAAATGACCCAAAGGGCCACAGG - Intronic
906178595 1:43798427-43798449 CAAATGAACTACAGGGAAATTGG - Intronic
909406123 1:75291629-75291651 CAGATGAACAACATGGACAAAGG + Intronic
909495282 1:76270963-76270985 GAGATGAACCCAAGGGACAACGG + Intronic
910062692 1:83112734-83112756 CAGAGGAAATAAAGTGACACAGG + Intergenic
911419481 1:97621860-97621882 TAGATATATTAAAGGGACACAGG + Intronic
911730338 1:101286297-101286319 CACATGGACTAAAGGGAGGCAGG - Intergenic
912012241 1:104981782-104981804 CAGATGAAAAAAAGGAAAACAGG + Intergenic
913063433 1:115228345-115228367 TAGATGAAGTAAAGGTAAACAGG - Intergenic
914456143 1:147838210-147838232 CAGATGATGTTAAGGGCCACAGG + Intergenic
918787252 1:188777755-188777777 CATATCAACAAAAGGGACACAGG - Intergenic
919503621 1:198369676-198369698 CACATGAACAAAAGGCACAAAGG - Intergenic
921745497 1:218735819-218735841 CAGATGAACTAAAAGGTTAATGG + Intergenic
1062795340 10:341047-341069 CAGGAGAAGTAGAGGGACACGGG + Intronic
1065914338 10:30340615-30340637 TAGATGAAGAAAAGGAACACTGG + Intronic
1066068594 10:31781198-31781220 CAGGTGAATTGAAGGGAAACAGG + Intergenic
1066227268 10:33395372-33395394 GAGATGAAATAAAGGGATATGGG + Intergenic
1066495183 10:35935630-35935652 CAAATAAACAAAAGGGACATTGG - Intergenic
1066499381 10:35974975-35974997 AACATGAACCAAAAGGACACAGG + Intergenic
1067409577 10:46052823-46052845 CAGCTGAACTGAAGGGTCAGTGG - Intergenic
1069437611 10:68399738-68399760 AAGATAAACTAAAGGGAGGCTGG + Intronic
1070394395 10:75999550-75999572 CAGAGGAACTAGAGGCACATTGG - Intronic
1070545776 10:77451331-77451353 CAGATCAACTTCAGGGGCACAGG - Intronic
1074261193 10:111855188-111855210 CAGAAAAACTAAAGGGACATAGG - Intergenic
1074564894 10:114568425-114568447 AAGAGGAACTAAAGTCACACAGG + Intronic
1077300828 11:1846214-1846236 CAGGGGAACAAAAAGGACACAGG - Intergenic
1078985442 11:16590409-16590431 TAGCTGAACTAAAGGAACAAAGG + Intronic
1079196237 11:18329744-18329766 CAGAGAAAGTAAAGGGAAACAGG - Intronic
1080543134 11:33288494-33288516 CAGGTGACCTAAAGAGTCACGGG - Intronic
1081238724 11:40678318-40678340 AAGATGGATTAAATGGACACTGG - Intronic
1081493294 11:43583045-43583067 AAGAGGAGCTGAAGGGACACAGG - Intronic
1082236446 11:49823873-49823895 CGGATAAACTGAAAGGACACCGG + Intergenic
1082242250 11:49885971-49885993 CAGATAAACTGAAAGGACACCGG - Intergenic
1082656753 11:55866775-55866797 CGGATAAACTGAAAGGACACCGG - Intergenic
1083703140 11:64494290-64494312 GAGATGAATTAAAAGGACAGAGG - Intergenic
1084911609 11:72394330-72394352 CAGCTGAACTGAATGAACACTGG + Intronic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1086852679 11:91828965-91828987 AAGATGAACAAAACAGACACAGG + Intergenic
1090854960 11:130603076-130603098 CAGAGGAACTGGAGGGACCCTGG + Intergenic
1091911811 12:4238277-4238299 CAGATGAACTTAAGTAAAACAGG - Intergenic
1096705476 12:53418901-53418923 CACAAATACTAAAGGGACACAGG - Intergenic
1096714140 12:53481005-53481027 CTGATAAACTCTAGGGACACTGG - Intronic
1098190114 12:67938978-67939000 CAGCTGAACTGAAGTTACACTGG + Intergenic
1098192043 12:67959805-67959827 AAGTTGAAATACAGGGACACAGG + Intergenic
1099178568 12:79452241-79452263 CAGATGAACTGATGACACACAGG - Intergenic
1099194733 12:79602418-79602440 GAGATGAGCTAAACGGAGACAGG + Intronic
1101754778 12:107612994-107613016 CACAGCAACTAAAAGGACACAGG - Intronic
1102569582 12:113819309-113819331 CAGAGGGGCCAAAGGGACACAGG - Intronic
1103554722 12:121759045-121759067 CAGATGGTTTAAGGGGACACAGG + Intronic
1104659573 12:130600799-130600821 CAGATGAACTACCGGATCACGGG - Intronic
1106358575 13:29008459-29008481 CAGATGAACCAAAAGGAAATGGG - Intronic
1109053845 13:57520122-57520144 GATAGGAACTACAGGGACACCGG - Intergenic
1110608676 13:77464022-77464044 GAGATGAACTAGAGAGACAATGG + Intergenic
1110933346 13:81250817-81250839 TAGATGAACTAAAAGGAACCTGG + Intergenic
1111292084 13:86183722-86183744 CAAATGAACTAAAGGCACCAAGG + Intergenic
1113233055 13:108237067-108237089 CAGTTGAATTAATGTGACACTGG + Intergenic
1115473606 14:33793343-33793365 CCGATGAACTAAATTTACACTGG - Intronic
1116368432 14:44099938-44099960 AAGATGATGTAAAGAGACACAGG - Intergenic
1116788610 14:49315532-49315554 CAGAAGAACTTAGGGAACACAGG - Intergenic
1119901684 14:78265925-78265947 CAGATGAACAAGACAGACACAGG - Intronic
1120502642 14:85316010-85316032 CTGATGAAGTAAAAGGAGACAGG - Intergenic
1122946525 14:105013140-105013162 CAGATGCACTAGATGGACATTGG + Intronic
1122986231 14:105212879-105212901 CAGATGAACCCTCGGGACACTGG + Intronic
1125394183 15:39228997-39229019 GAGATGAACTAAAGAGGTACAGG + Intergenic
1126938314 15:53736685-53736707 CAGATGTAGTAAAGGAATACAGG + Intronic
1129169768 15:73800496-73800518 CTGCTGACCTAAAGAGACACAGG - Intergenic
1133518522 16:6533201-6533223 CAGATCAACTATAGTGATACAGG + Intronic
1137221732 16:46459475-46459497 CAAATGAATTAAAGACACACAGG - Intergenic
1137873136 16:51970138-51970160 CAGATGAACTAAACAGAGTCAGG - Intergenic
1138189416 16:55002131-55002153 CAGAGGAATTCAAGGGACATGGG - Intergenic
1141370878 16:83485330-83485352 CAGCTGATATAAAGGGAAACTGG - Intronic
1146255542 17:31390069-31390091 CAGACGAACTGAAGGGTCAAAGG + Intergenic
1147555381 17:41475759-41475781 CAGATGTCCTTAAGGGACAAGGG + Intergenic
1147764920 17:42828024-42828046 AAGATGATGTAAAGAGACACAGG + Intronic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1151517821 17:74607764-74607786 CACATGAACCATATGGACACAGG - Intergenic
1154509613 18:15082701-15082723 AAGAGGAGCTAAAAGGACACAGG + Intergenic
1156167021 18:34434158-34434180 CAAATGAACTAAATGTACATTGG - Intergenic
1157131201 18:45008991-45009013 CAGATGAACGAACAGGAGACTGG + Intronic
1157205093 18:45691319-45691341 CAGATGAAGGGAAGGGACAAAGG - Intergenic
1157211298 18:45744850-45744872 CAGCTGAACTGAAGGGCCTCAGG - Intronic
1159347065 18:67219999-67220021 GAGATGAAGGAAAGGAACACCGG + Intergenic
1159550964 18:69895102-69895124 CAGATCCCCAAAAGGGACACAGG - Intronic
1165138685 19:33686541-33686563 CTGATGAACAAAGGGGACTCGGG - Intronic
1165298586 19:34950417-34950439 CAGTTGAAATGAAAGGACACTGG + Intergenic
1165523472 19:36332302-36332324 CGGAGGACCTACAGGGACACTGG + Intergenic
1167698392 19:51027901-51027923 CAAATGCACTGAAGGGAAACTGG - Intronic
926115555 2:10210740-10210762 CATATGAACCCAGGGGACACAGG - Exonic
926192448 2:10738991-10739013 CAAATGAATGAAAGGGAAACGGG - Intronic
927108684 2:19848957-19848979 GAGATGAAGTAGAGGGACAGAGG - Intergenic
929630022 2:43450039-43450061 AAGCTGAAATAAAAGGACACTGG + Intronic
930737209 2:54791623-54791645 GAGAAGAACAAAAGGGATACCGG - Intronic
930844534 2:55888104-55888126 CAGATGAACCAATGGGTCATAGG + Intronic
931668060 2:64624379-64624401 CAAATGAGCTAATGGGCCACAGG + Intergenic
934589297 2:95531769-95531791 CAGATAAACCGAAAGGACACTGG + Intergenic
937108334 2:119340233-119340255 AAGATGAACCAAAGTAACACAGG + Exonic
938671321 2:133589135-133589157 CAGAGAAACCAAGGGGACACAGG + Intergenic
943655578 2:190505019-190505041 GTGATGAACTAGAGGGAAACTGG + Exonic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
1169326309 20:4679456-4679478 CAGATGGGCCAAGGGGACACAGG + Intergenic
1172505249 20:35456533-35456555 TAGAAGAACTAAAGGAACAGAGG - Intronic
1173125678 20:40333723-40333745 CAGAGGAAGAAAAGAGACACAGG - Intergenic
1173547858 20:43913460-43913482 CAGATGAAAAAAATGGACACAGG + Intergenic
1173643754 20:44621046-44621068 CAGATGACCAAACGGGACATGGG - Exonic
1175470875 20:59226662-59226684 CACATGATTTAAAGGGACAGAGG - Intronic
1176788455 21:13289073-13289095 AAGAGGAGCTAAAAGGACACAGG - Intergenic
1177987608 21:27997278-27997300 AAGAGGAGCTAAAAGGACACAGG - Intergenic
1178352918 21:31885670-31885692 CAGACGATGTAAAGAGACACAGG - Intronic
1178448462 21:32667769-32667791 GAGATCAACTATAGGGACACAGG - Intronic
1181887293 22:26031446-26031468 AAGATGAACTGAGGAGACACAGG - Intergenic
1182012464 22:27012106-27012128 GAGAGGAACTAGGGGGACACTGG + Intergenic
949727060 3:7061412-7061434 CAGATGAGTAAAAGAGACACAGG + Intronic
951974680 3:28491984-28492006 CATATTAATTAAAGGGACAACGG + Intronic
952555960 3:34531566-34531588 AAGTTGAACTAAAGTGACTCGGG - Intergenic
952978955 3:38719856-38719878 CAGATGAAGGATAGGGGCACTGG - Intronic
954977567 3:54710963-54710985 CAGATGAATGACAGTGACACTGG - Intronic
955082674 3:55672573-55672595 CAGATGAAAATCAGGGACACAGG + Intronic
956141388 3:66150121-66150143 CAGAAGATCTAAAGGTACAAAGG + Intronic
956476039 3:69621381-69621403 CAGATGAACTACTGAGACACAGG + Intergenic
958448728 3:94246845-94246867 CAGATGTACAAAAGTGACACTGG - Intergenic
959183893 3:103018909-103018931 CAGATGAGGAACAGGGACACTGG + Intergenic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
961373493 3:126447155-126447177 CAGATGAACTTAAAGTAGACAGG + Intronic
961696959 3:128712030-128712052 CAGAGGAACTAGAGGCACAAAGG + Intergenic
964948181 3:162251571-162251593 CAGATGAACTACAGCTTCACAGG + Intergenic
970577150 4:17438468-17438490 CTGATGAACTCAAGTGAAACGGG + Intergenic
976748961 4:88434506-88434528 GAAATGAACTAAAGAGACACAGG + Intronic
976748969 4:88434553-88434575 GAAATGAACTAAAGAGACACAGG + Intronic
979237685 4:118420506-118420528 CAAATGAATTTAAGGGAGACCGG - Intergenic
979521344 4:121670942-121670964 CATATGAACAAAAGGACCACAGG + Intronic
981177506 4:141699689-141699711 CAAATAAACTTAAGGGAAACAGG - Intronic
982068470 4:151674750-151674772 CAGATGAACAAAATCAACACTGG - Intronic
983758620 4:171375992-171376014 CTGATTAAGTAAATGGACACTGG + Intergenic
984840681 4:184064772-184064794 CTGATGCACTGAAGGGACAACGG - Intergenic
985001630 4:185490432-185490454 CAGTTGAAATAAAAAGACACTGG - Intergenic
986449003 5:7848596-7848618 AGGATGATGTAAAGGGACACAGG - Intronic
986734248 5:10656448-10656470 CAGATGAACTAAAGGGACACTGG + Intergenic
989619292 5:43368744-43368766 AAGATGATGTGAAGGGACACTGG + Intergenic
990475917 5:56161784-56161806 CACATACACTAAAGGGACAATGG + Intronic
990813107 5:59751019-59751041 CAGAAGAACAATAGGTACACAGG + Intronic
990828292 5:59927074-59927096 CACATGAACTAAAGGAAGAGTGG + Intronic
992323636 5:75638822-75638844 CAGAGGAACAAAAAGGAAACTGG - Intronic
992778321 5:80106847-80106869 AAGATGATGTAAAGAGACACAGG - Intergenic
996806343 5:127458977-127458999 TAGATCAACAAAAGGGAAACTGG - Exonic
998007007 5:138663680-138663702 CTGAAGAACTAAAAGGAAACCGG - Intronic
998951091 5:147393665-147393687 GAAATGAACAAAAGGGACGCAGG - Exonic
999157909 5:149471745-149471767 CAGAAGAAATACAGGGACACAGG - Intergenic
1004478450 6:15996469-15996491 CTGGTGAACAAGAGGGACACAGG - Intergenic
1004551163 6:16648519-16648541 CAGAATAGCTAAAGGGAAACTGG + Intronic
1005019504 6:21404187-21404209 CAGATGAAATAAAGCTTCACTGG - Intergenic
1005176353 6:23049320-23049342 CAAATGAACTTAAGAGAAACAGG + Intergenic
1010785088 6:79991709-79991731 CAGATGAACCAAATAGACATGGG - Intergenic
1011161647 6:84397468-84397490 CACATGGACACAAGGGACACAGG + Intergenic
1013514225 6:110871048-110871070 AAAATGACCTAAAGGGAGACAGG + Intronic
1013987472 6:116212983-116213005 CAGATGAAATAAAAGTAAACAGG - Intronic
1021265137 7:18511075-18511097 CAAATTCACTAAAAGGACACTGG - Intronic
1023127742 7:36972574-36972596 AAGATGATGTAAAGAGACACAGG - Intronic
1024408475 7:49010620-49010642 CAGAGTAAAGAAAGGGACACTGG + Intergenic
1024418104 7:49131864-49131886 CAGATGAAAGAACGAGACACTGG + Intergenic
1024797969 7:53040464-53040486 CAGATAAAGGAAAGGGACAAAGG + Intergenic
1026731209 7:72913387-72913409 CAGATAAAGTAAAGGAAGACTGG - Intronic
1027112873 7:75454682-75454704 CAGATAAAGTAAAGGAAGACTGG + Intronic
1027285119 7:76639293-76639315 CAGATAAAGTAAAGGAAGACTGG + Intergenic
1028542960 7:91964659-91964681 CAGATGAACTAAAAGAAAACTGG - Intronic
1030024123 7:105305562-105305584 CAGAAGAATTAAAGTAACACAGG - Intronic
1030079324 7:105763588-105763610 CAGATGAGCAAAAAGGGCACAGG - Intronic
1032467845 7:132157732-132157754 CAGATGAAACAAAGGAACAGTGG + Intronic
1032682560 7:134200588-134200610 TAGATGAACTAGATGGACAGGGG + Intronic
1034896556 7:154879936-154879958 CAGATGAACAAGAGGAAAACCGG - Intronic
1036629257 8:10499077-10499099 GAGATGCACCAAAGGTACACAGG + Intergenic
1036713993 8:11103239-11103261 GAGATGAACAAAAAAGACACAGG + Intronic
1037505681 8:19527177-19527199 CAGAGGAACAAAAGGAACAAAGG + Intronic
1044207301 8:89505523-89505545 CAGATAAACTAAAAGTACACAGG + Intergenic
1044489274 8:92792791-92792813 CAGCTTATCTAAAGTGACACAGG - Intergenic
1046510049 8:115190961-115190983 TAGATTCTCTAAAGGGACACTGG - Intergenic
1047692089 8:127366248-127366270 GAGAGGAACTAAAGTTACACTGG - Intergenic
1051077863 9:13261494-13261516 CAAATGAAATAAAGGAACAAGGG - Intronic
1057032765 9:91789320-91789342 AAGATGAAATAAAAGAACACTGG + Intronic
1057976444 9:99610458-99610480 CAAATGCACTAAAGGGTCACAGG - Intergenic
1061785854 9:133027848-133027870 CAGACAAACTAGAGGGTCACTGG + Intergenic
1185974613 X:4706271-4706293 CAGAACAACTAAAAGGACAAAGG + Intergenic
1187889557 X:23921523-23921545 AAGCTGAACTAAAGGGAAAAAGG - Intronic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1188965919 X:36550946-36550968 CAGATGAACAAAAGACACATTGG + Intergenic
1189156255 X:38759887-38759909 CAGGTGAACTAAGGGGTCTCTGG + Intergenic
1189490636 X:41469153-41469175 CAGATGACCTGAAAAGACACTGG + Intronic
1189701117 X:43716870-43716892 CACATGGGCTAAGGGGACACAGG + Intronic
1190873895 X:54446259-54446281 CAGAGGAACTACAGCGACGCTGG - Exonic
1192583704 X:72304796-72304818 CAGAAGATCTGAATGGACACAGG - Intronic
1193846037 X:86472104-86472126 CAGAGGAATAAATGGGACACTGG + Intronic
1194478039 X:94383921-94383943 AAGCTGAAATAAAAGGACACAGG + Intergenic
1194555365 X:95351953-95351975 CAATGGAACTAAAGGAACACAGG - Intergenic
1197878093 X:131133026-131133048 AAGATGATGTAAAGAGACACAGG + Intergenic
1198137855 X:133772039-133772061 CAGGAGAAGGAAAGGGACACAGG - Intronic
1199965874 X:152820414-152820436 AAGATGATGTGAAGGGACACAGG - Intergenic