ID: 986741292

View in Genome Browser
Species Human (GRCh38)
Location 5:10707664-10707686
Sequence CGATCAGTGTGGTGCACAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986741292 Original CRISPR CGATCAGTGTGGTGCACAGG CGG Intronic
900871892 1:5310286-5310308 AGAGCTGTGTGGTGCACAAGTGG - Intergenic
904052082 1:27645879-27645901 CGATCAGAGTATTGCACAGTGGG + Intergenic
921092827 1:211859503-211859525 CTTTCTGTGTGGTGCACAGCAGG - Intergenic
923085730 1:230702318-230702340 CCATCTGTGTGATGGACAGGGGG - Intergenic
923801879 1:237218370-237218392 TAATCAGTGTGGTGCACAGTAGG - Intronic
1065000916 10:21336871-21336893 CACTGAGTGTGGTGCACAGGGGG - Intergenic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1075588624 10:123675632-123675654 CAATCAGTTTTGTGCACTGGAGG + Intronic
1076049836 10:127323615-127323637 TGATCCGTGGGGTGCACAGAAGG + Intronic
1090825658 11:130383769-130383791 GTCTCAGTGTGCTGCACAGGAGG + Intergenic
1093652080 12:21657570-21657592 CGCTCAGTTTGGGGCGCAGGGGG - Exonic
1105811730 13:24001623-24001645 GGATGAGTGTGGTGCCCTGGTGG - Intronic
1108337774 13:49463661-49463683 CCTTCACTGTGGTGCCCAGGTGG + Intronic
1113473506 13:110562981-110563003 CGAGCAGTGTGGGGCTGAGGTGG + Intergenic
1113683229 13:112259707-112259729 AGATTAGTGTGGAGCACAGGAGG - Intergenic
1116957941 14:50943625-50943647 GGCTAAGTGTGGTGCAGAGGAGG - Intronic
1122773743 14:104108234-104108256 AGAACAGGGTGGTGGACAGGAGG + Intronic
1122844520 14:104484970-104484992 GGATCCCTGTGGTGCACAGCAGG + Intronic
1128243642 15:66118364-66118386 AGAGCAGTGTGGTGCAGTGGAGG - Intronic
1129194559 15:73956185-73956207 CGCACAGTGTAATGCACAGGGGG - Intergenic
1130560669 15:84955785-84955807 CTATCAGGGTTGTGGACAGGAGG + Intergenic
1132556758 16:576030-576052 GGGTCAGCGTGGTGCAGAGGGGG - Intronic
1133155398 16:3871337-3871359 CGGTCAGTGTGGTGCTGAGGAGG - Intronic
1134852205 16:17488964-17488986 CAATCAGTGGGGAGCACAGGTGG - Intergenic
1136569624 16:31088829-31088851 CTCTCAGAGTGGAGCACAGGTGG - Exonic
1142763030 17:2052336-2052358 CGAAGAGTGAAGTGCACAGGAGG + Intergenic
1148577637 17:48722926-48722948 CGAACTGGGAGGTGCACAGGGGG - Intergenic
1151843473 17:76634424-76634446 CTAACAATGTGGGGCACAGGAGG - Intronic
1152531444 17:80921776-80921798 GGAGCAGGGTGGTGCACAGCTGG - Intronic
1157617699 18:48997007-48997029 AGTTCAGGGTGGTGCCCAGGAGG - Intergenic
1163176299 19:15566202-15566224 CGCAGAATGTGGTGCACAGGAGG - Intergenic
1163291079 19:16379360-16379382 AGATCAGAGTGGGGCAGAGGTGG + Intronic
1166230152 19:41421838-41421860 TGACCAGGGTGGTGCAGAGGAGG + Intronic
925156012 2:1649370-1649392 CGATCAGGGTGGTGGACACCAGG + Exonic
925185286 2:1842693-1842715 CGGTCAGTGGGGTGCAGGGGTGG - Intronic
932700194 2:73986211-73986233 CGATCAGACTGCTGCAGAGGAGG + Intergenic
933247456 2:79991708-79991730 TGATCAGTGAGATGCACTGGTGG + Intronic
935664528 2:105498588-105498610 CGGTCAGTGTGTTGCAAAGCTGG - Intergenic
1170725613 20:18923619-18923641 CCATCAGTGTGGTACAAAGCTGG - Intergenic
1172999975 20:39098662-39098684 TGAACAGCCTGGTGCACAGGAGG + Intergenic
1173432234 20:42998882-42998904 CCATCAGTGGGGTGCAGAGGAGG - Intronic
1179385135 21:40934270-40934292 CGCTCAGAGTGATGCAAAGGGGG + Intergenic
1181982853 22:26778357-26778379 TGATCAGTGTTGTACAGAGGAGG + Intergenic
950520333 3:13494358-13494380 GGATGAGTGTGGTGAACAAGAGG + Intronic
951761053 3:26147965-26147987 CGATCATCATGGTGGACAGGAGG + Intergenic
959897810 3:111624978-111625000 CGATCAGTGTGGTGGGGAAGTGG + Intronic
962271237 3:133979429-133979451 TGGTCAGCGTGGTGCACAAGTGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
978760968 4:112356281-112356303 AGGCCAGGGTGGTGCACAGGAGG - Intronic
986741284 5:10707600-10707622 TGAGCAGTGTGGTGCACAGGCGG + Intronic
986741292 5:10707664-10707686 CGATCAGTGTGGTGCACAGGCGG + Intronic
987937664 5:24488034-24488056 CGATGAGGGTGGTGGAGAGGAGG - Exonic
990134767 5:52631742-52631764 CGATCATTGTGGTGCGAAGGTGG - Intergenic
997251997 5:132396281-132396303 GGTTGAGTGTGGTGCACAAGAGG + Intergenic
1013196151 6:107846926-107846948 TGTTCAGGGTGGTGTACAGGTGG + Intergenic
1025097216 7:56105636-56105658 CGCCAAGTGTGGTGCACAGGTGG + Intronic
1027628540 7:80574690-80574712 CCCTCAGTGGTGTGCACAGGTGG + Intronic
1032321649 7:130891313-130891335 AGAGCTGTGTGGTGCAGAGGAGG + Intergenic
1037499095 8:19468514-19468536 AGAGCAGTGTGGGGCGCAGGTGG + Intronic
1044427638 8:92071523-92071545 CTGTCAGTGTGGTCCACAAGGGG + Intronic
1048342696 8:133553128-133553150 CAAACAGTGGGGTGCACAGGGGG - Intronic
1049167519 8:141135927-141135949 AGATCAGTGTGGTAGAAAGGAGG + Intronic
1056579950 9:87883374-87883396 TCATCTGTGGGGTGCACAGGAGG + Intronic
1060062719 9:120475564-120475586 CGAGCAGTGGGGGGCACTGGGGG - Intronic
1060344123 9:122801893-122801915 AGCTCAGTGTGGCACACAGGAGG + Intronic
1061508970 9:131048972-131048994 CGATCAGTGTGAGGCCCCGGAGG - Intronic