ID: 986744193

View in Genome Browser
Species Human (GRCh38)
Location 5:10730176-10730198
Sequence AACAAAATCCCTCTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986744193_986744194 15 Left 986744193 5:10730176-10730198 CCTGTGAGAAGAGGGATTTTGTT 0: 1
1: 0
2: 1
3: 27
4: 253
Right 986744194 5:10730214-10730236 TCCCCACTGTGTAGAGTACCTGG 0: 1
1: 0
2: 0
3: 8
4: 94
986744193_986744198 26 Left 986744193 5:10730176-10730198 CCTGTGAGAAGAGGGATTTTGTT 0: 1
1: 0
2: 1
3: 27
4: 253
Right 986744198 5:10730225-10730247 TAGAGTACCTGGCACAGACGAGG 0: 1
1: 0
2: 2
3: 21
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986744193 Original CRISPR AACAAAATCCCTCTTCTCAC AGG (reversed) Intronic
900090689 1:919158-919180 AACAAAAGCCCTGCTCTCAGGGG + Intergenic
900388552 1:2422367-2422389 AGCCACGTCCCTCTTCTCACTGG - Intergenic
900634554 1:3656186-3656208 AAAAAAATCCCTCTGCTCATTGG + Intronic
902429666 1:16353086-16353108 AGCAAAGTCCCCCTTCTCAAGGG + Intronic
904767259 1:32860041-32860063 AAAAAAATTCCACTTGTCACAGG + Intergenic
904872780 1:33630764-33630786 AACAAAATCCATATTCTTAGGGG + Intronic
906022702 1:42644609-42644631 AACTACATCCCACTTCCCACTGG - Intronic
906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG + Intronic
910944124 1:92570140-92570162 AACAAAATCATTATTCTCATAGG + Intronic
911281437 1:95934330-95934352 AAAAAAATCCCCCTTTTCCCTGG - Intergenic
912203840 1:107488868-107488890 CTCAAAATCCATCTTCACACTGG + Intergenic
912409694 1:109472103-109472125 AACAAAATCTCTGTCCTCATGGG - Intronic
914954714 1:152151122-152151144 AACAAAATCCTTGTTCTTATGGG + Intergenic
916783655 1:168065209-168065231 AGCAAAGTCCCTCTTCTTAGGGG + Intronic
916875626 1:168965295-168965317 AACAAACACCCTCTTCTCCTTGG - Intergenic
918823022 1:189283678-189283700 AAAAAAATCCATACTCTCACAGG + Intergenic
919747225 1:201016519-201016541 AGCAAAATCCCTGCTCTCAGGGG + Intronic
920224263 1:204426653-204426675 AACAAAATCCCTGCCCTCAGGGG - Intronic
920738555 1:208558290-208558312 AACAAAATCAGACTTCCCACAGG + Intergenic
921287274 1:213620588-213620610 AATAAAATCCCACCTCTCAATGG + Intergenic
922797259 1:228346482-228346504 AACAGAATCCCTCTTCCCCAAGG - Intronic
922919362 1:229288569-229288591 AACTAAATGCATCTTCTCAATGG + Intronic
923357876 1:233178632-233178654 AACAAAATCTTTCTTTTCAGAGG + Intronic
924171341 1:241344713-241344735 AACAAAATACCTCTTTTCATAGG - Intronic
924397419 1:243637039-243637061 AACAAAATCCCAATTCCCTCAGG - Intronic
1063981382 10:11454719-11454741 AACAAAGTCCCTGTCCTCATGGG - Intronic
1064495678 10:15907601-15907623 GAAAAAATCCCTCTTCTTGCTGG + Intergenic
1070233578 10:74598387-74598409 AACAAAATATGTCTTCTCACAGG + Intronic
1070716717 10:78727714-78727736 AACAAAATACCTCTTCTGTGTGG - Intergenic
1070814027 10:79312192-79312214 CCCAACATCCCTCTTCTCAAGGG - Intronic
1071358256 10:84819196-84819218 CTCAAAATCACCCTTCTCACTGG + Intergenic
1072825916 10:98606094-98606116 GACAAGATCCCTGTCCTCACTGG - Intronic
1073865501 10:107799756-107799778 AACACAATCTCTCTTCTTTCAGG + Intergenic
1076562790 10:131377880-131377902 AACGGCAGCCCTCTTCTCACTGG + Intergenic
1077460761 11:2708268-2708290 AACAGGATCCCTTTCCTCACTGG + Intronic
1078573958 11:12483120-12483142 AGGAAAATCACCCTTCTCACAGG + Intronic
1079745667 11:24125766-24125788 AAACAAATCCCTTTTCCCACAGG + Intergenic
1080229139 11:29998084-29998106 GACAAAATTCCTCTTTTCACTGG - Intergenic
1081750714 11:45508940-45508962 AGCAAAATGCCTCTGCTCAGGGG + Intergenic
1090197518 11:124829402-124829424 AACAAATTCTCTCTTCCCCCAGG - Intergenic
1092518860 12:9245184-9245206 AACAAACTCCCACATCTCAGCGG - Intergenic
1093034313 12:14319004-14319026 ATCTAAATCTCTCTACTCACTGG - Intergenic
1093179470 12:15950829-15950851 AACAAAATCCTTATTCTCATAGG - Intronic
1096182735 12:49559535-49559557 TCCAAACTCCCTCTTCTCCCAGG - Exonic
1096547328 12:52349449-52349471 AACAAAAGCACTGTTATCACGGG - Intergenic
1097435528 12:59549013-59549035 AAAAAAACCCCTCATCTCACTGG - Intergenic
1099465887 12:82987668-82987690 AACAAAAACCACCTTCTCACTGG - Intronic
1101375946 12:104171832-104171854 GACAAAATCCCTCTCCAAACTGG + Intergenic
1103043382 12:117714685-117714707 CACAAAGTCCCTGTTCTCAATGG + Intronic
1103136401 12:118511589-118511611 AACACAATCCCTGTTGTCATGGG + Intergenic
1104114658 12:125737775-125737797 AACAATAACCCTCATCTCCCAGG + Intergenic
1104239485 12:126974052-126974074 AACAAACTACCTCTTCTCTATGG - Intergenic
1104764999 12:131324328-131324350 AGCAAAATGCCTCTTCTCCTTGG + Intergenic
1105733636 13:23245572-23245594 AACAATCACCCTCTTGTCACAGG - Intronic
1105810791 13:23993493-23993515 AACAACATCACTCTTCTGAGAGG - Intronic
1107162394 13:37246435-37246457 AAAAAAGGCCCTCTTCTCCCTGG + Intergenic
1108301838 13:49085384-49085406 AAGCAAAGCCCTCTTCTCTCAGG + Intronic
1108516308 13:51206149-51206171 AGGAAAATCCCTCTTTTCTCGGG - Intergenic
1108870517 13:54978520-54978542 AGCAAAATCCCTCTGCTCACAGG + Intergenic
1109532530 13:63669257-63669279 AGAAAAATTCCTCTTCTCACTGG + Intergenic
1110543950 13:76736101-76736123 CACAAAATCCCTCTTCACTTTGG - Intergenic
1111287112 13:86109484-86109506 AACAGGATCCATCTTGTCACTGG + Intergenic
1111640868 13:90968266-90968288 AACTAATTCCCTCTTCTTCCTGG + Intergenic
1111641928 13:90980112-90980134 GACAATGGCCCTCTTCTCACAGG + Intergenic
1113327784 13:109299400-109299422 AAGGAAATTCCTCTTCTCATTGG + Intergenic
1114854046 14:26416090-26416112 AAAAAATTCCTTCTTCCCACAGG + Intergenic
1115370680 14:32610635-32610657 CACAAAATCCATCTTCTCTTAGG - Intronic
1115990563 14:39145626-39145648 AAGAAAATCCCTTATCTCGCCGG + Intergenic
1116307449 14:43276137-43276159 AACAAAAACATTATTCTCACTGG - Intergenic
1116605060 14:46981501-46981523 TACAAAGTCCCTCTTTTCATAGG + Intronic
1118010424 14:61605125-61605147 AACAAAATCAATCTTCTGATAGG - Intronic
1120824161 14:88940228-88940250 AACATGGTCCCTCTTCTCACAGG - Intergenic
1120841396 14:89088588-89088610 AACAAACTCTCTCTCCTCAGAGG - Intergenic
1120936975 14:89906649-89906671 AACAAAATCTTTCATCTCAAAGG - Intronic
1121751292 14:96359440-96359462 AACAAAGACCCTTTTCTTACAGG - Intronic
1124049368 15:26180693-26180715 AACAAAAGCCCTCCTCTCTGGGG - Intergenic
1124685819 15:31781097-31781119 CACAGAACCCCTCCTCTCACTGG - Intronic
1127002850 15:54530463-54530485 AACAAAATTCCTGCTCTCATGGG + Intronic
1127809802 15:62554998-62555020 AAAAAAAACACCCTTCTCACTGG + Intronic
1128138027 15:65278372-65278394 AACAAAACCCGTCAGCTCACAGG + Intronic
1128888575 15:71310792-71310814 AAGTGAATCCCTCTTCTCCCAGG - Intronic
1129258713 15:74350442-74350464 GACAAGACCCTTCTTCTCACTGG + Intronic
1129900437 15:79144121-79144143 GACAGTAGCCCTCTTCTCACAGG + Intergenic
1131230899 15:90658598-90658620 AACAAGATCCCTGCTCTCATAGG + Intergenic
1131454567 15:92573019-92573041 CACAATCTCCTTCTTCTCACCGG + Intergenic
1131793051 15:95985642-95985664 AACCAAATCTCTCTTCTCTGGGG - Intergenic
1131853325 15:96565639-96565661 AAAAAAATGCCTCATCACACTGG - Intergenic
1132596225 16:751665-751687 AAAAAAATACCTCTTCTCTTTGG - Intronic
1133652216 16:7823052-7823074 AGCAAATTCCCTCTTCTGTCTGG + Intergenic
1136521363 16:30798335-30798357 AACAGAAACCATCTTCTTACTGG + Intergenic
1137421605 16:48339685-48339707 AACAAAAGCCATTTCCTCACTGG - Intronic
1138731557 16:59200947-59200969 CAAAAAATCCCTCTTTTCATGGG + Intergenic
1138930010 16:61641977-61641999 CACAAATGCCCTCTTCTCAATGG + Intergenic
1140282636 16:73568626-73568648 GAGAAAAGCCCTCTTCCCACCGG + Intergenic
1141451895 16:84109418-84109440 AACAAAATATCTCTTTTCAAAGG + Intronic
1143406214 17:6678613-6678635 ACAAAAATCCCTGTTCTCATAGG + Intergenic
1144287898 17:13796304-13796326 AAAATAATCCCTGTTCTCAAAGG - Intergenic
1148621807 17:49040224-49040246 AATAAAATCTTTCTTCTTACAGG + Intronic
1150180507 17:63114612-63114634 TACGAAATCTCTATTCTCACAGG - Intronic
1151022939 17:70640204-70640226 TAGAAAATCCTTCTTCTCAGCGG + Intergenic
1151163014 17:72181645-72181667 ACCAAAGTGCCTGTTCTCACGGG - Intergenic
1153928480 18:9856948-9856970 AACAAAATGCCTCTTCTACTTGG - Intronic
1155121870 18:22829119-22829141 AACAAGATTCCTGTTCTCATGGG - Intronic
1157807284 18:50667638-50667660 AAAAAAATGCCCCTTCTCCCTGG + Intronic
1158342636 18:56483273-56483295 AAAAAGGTCCCTCTTCTCAAAGG - Intergenic
1158793474 18:60811757-60811779 AACCAAATCCCACTGCTGACTGG - Intergenic
1158865570 18:61635082-61635104 ACCAAAATCCCCCTTCTCCAAGG + Intergenic
1163854776 19:19692732-19692754 AATCAAATTCCTATTCTCACTGG + Intergenic
1164798009 19:31051717-31051739 AACCAATTCCCCCTTCTCATTGG - Intergenic
1165996247 19:39846144-39846166 ATCAGAATCCCCCTTCCCACAGG + Intronic
1166313014 19:41973725-41973747 GACACCATCCCTGTTCTCACAGG - Intronic
1167049775 19:47071295-47071317 ATCTAAACCCCTCTGCTCACTGG + Intronic
925110356 2:1330313-1330335 CACAGAATCCCTCTCCTCAGAGG - Intronic
925710182 2:6731536-6731558 AAGAAACCCCTTCTTCTCACAGG + Intergenic
925976194 2:9143669-9143691 AGCAAAGTCCCTCTTCTGTCTGG + Intergenic
927379764 2:22465400-22465422 AACAAATTCCTTGTTCGCACAGG + Intergenic
929085770 2:38165901-38165923 AACACAAGCTCTCTTTTCACTGG - Intergenic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
930541901 2:52716974-52716996 ACCAATATCCATCTTCACACAGG + Intergenic
931749766 2:65319968-65319990 AACAAAATACCTCTTAGCATAGG - Intronic
931881931 2:66577408-66577430 AACTAAATCCCTTTTCTCCAGGG - Intergenic
932069517 2:68604624-68604646 AATAAAAAGGCTCTTCTCACAGG + Intronic
933237038 2:79875279-79875301 AATAAATTCCAACTTCTCACAGG - Intronic
933334386 2:80937976-80937998 AACAAAATCCCTCCTAACAAAGG - Intergenic
933547475 2:83732901-83732923 AACAAAATACATCTTCTCAGGGG - Intergenic
933729582 2:85446615-85446637 AGGAAAGTCCATCTTCTCACGGG - Intergenic
934748962 2:96779558-96779580 GAGAAGATCCCTTTTCTCACTGG + Intronic
936688862 2:114861914-114861936 GACAAAATCTCTCTTTTCTCGGG - Intronic
937021817 2:118664183-118664205 CATAAAATCCCTCTTCCCAAAGG - Intergenic
937483121 2:122283409-122283431 GACAAAATCCCTCTTCTGCTAGG - Intergenic
938538146 2:132262171-132262193 AGCAAAGTCTGTCTTCTCACAGG + Intergenic
939967752 2:148627114-148627136 AATTAATTCCCTCTTCACACAGG - Intergenic
941423327 2:165311538-165311560 TACCTAATCCCACTTCTCACAGG + Intronic
941817436 2:169811391-169811413 AGCCAAATCCCTATTCTCTCTGG - Intronic
941852185 2:170195223-170195245 AACAGAATGCCTCTTCCCACTGG - Intronic
944534868 2:200698730-200698752 AACAATGCCACTCTTCTCACTGG - Intergenic
944563839 2:200967855-200967877 AAAAAAATCCATTTTCTCCCTGG + Intergenic
945515170 2:210754522-210754544 AAGCAAATCTCTCTTCTCGCTGG - Intergenic
947392428 2:229652969-229652991 CACAAAATCTTTCTTCTCCCCGG + Intronic
1170791971 20:19516002-19516024 AACCAAGTCCCTGTTCTCATGGG - Intronic
1171867051 20:30493956-30493978 AGCAAAGTCTGTCTTCTCACAGG + Intergenic
1172086257 20:32385762-32385784 AAAAAAATCCCTCTGGCCACTGG - Intronic
1172652300 20:36512532-36512554 AACAAAATCCCTCCCCTCATGGG + Intronic
1172864251 20:38083498-38083520 AACAAAACCCCTGATCTCATAGG - Intronic
1173804757 20:45917220-45917242 AACAAAATTCCAGCTCTCACGGG - Intergenic
1174156071 20:48516147-48516169 AACAAGATCTCTCTCCTCCCTGG + Intergenic
1178555373 21:33586371-33586393 AACAAATTCCCGCTTCCCATAGG - Intronic
1181347437 22:22230201-22230223 AGCAAAATCACTCTTCTCCTCGG - Intergenic
1181372476 22:22429307-22429329 AAAATAATCCCTTTTCTTACTGG + Intergenic
1181571866 22:23772359-23772381 AATAATATCCCTTTCCTCACAGG + Intronic
1182401648 22:30082243-30082265 AAGAAAATCCCTTTTCTATCAGG - Intronic
950235039 3:11311801-11311823 AAAAAATTCCCTCTTCACAATGG - Intronic
950276964 3:11670007-11670029 AACAGAATCCCTCTTCCAGCAGG + Intronic
951043899 3:18017021-18017043 AACAAAAGTCCTTCTCTCACTGG - Intronic
951598917 3:24350666-24350688 AGCAAAAACTCTCTTCACACCGG - Intronic
951928250 3:27934242-27934264 AACATACTCACTCTTCTCATTGG + Intergenic
952207267 3:31192289-31192311 GACAAAACCCCTCTTCTTCCTGG + Intergenic
953543459 3:43842701-43842723 AACAAAATCCAACCCCTCACAGG + Intergenic
953721194 3:45356667-45356689 AACAAGACCCCTCTTCTCAGCGG + Intergenic
955543042 3:59998463-59998485 CATAAAATCCCTCTTTTCAGTGG - Intronic
956489799 3:69758628-69758650 AACAAATTCCCTGTTCCCATGGG - Intronic
960014212 3:112868127-112868149 AACAAAAACCCTTTTATCAAAGG - Intergenic
961461198 3:127051443-127051465 GACAAAACCCTTGTTCTCACAGG - Intergenic
963319152 3:143794084-143794106 CACAAAATCCCTCTGCTTACAGG + Intronic
963529448 3:146455715-146455737 AGCAAAGTCTCTCTTCTCACAGG - Intronic
963993557 3:151681012-151681034 CACAAAATTCCTTTCCTCACTGG + Intergenic
964259401 3:154818236-154818258 AACTAAATATCTTTTCTCACTGG - Intergenic
965415657 3:168389139-168389161 ACCAGAATCCCTCTTCTCCAAGG + Intergenic
965563520 3:170085520-170085542 AACCAAAACCCTCTTCTTCCAGG - Intergenic
967297627 3:187980685-187980707 AACAAGATCCCTCAGGTCACTGG + Intergenic
967480837 3:189971606-189971628 AAAAAAATTCCTGTTCTCCCTGG - Intronic
967987275 3:195104816-195104838 ACCAAAAACCCTCTTCTGTCTGG + Intronic
969044311 4:4325642-4325664 GACAAATGCCCTCTTCTCACTGG + Intergenic
969956492 4:10896348-10896370 AATAAAAGTCCTTTTCTCACAGG - Intergenic
970129151 4:12847507-12847529 AAGAAATTCCCTCATATCACTGG + Intergenic
970136682 4:12932862-12932884 GCCATAATCCCTCTTCTCTCTGG + Intergenic
970405587 4:15759904-15759926 AACAAAATCCCTCCTCACATAGG - Intergenic
970526530 4:16938095-16938117 AACAAATTCCTTGTTCTCAGAGG - Intergenic
973586116 4:52393226-52393248 ATCTAAATCCCTGTCCTCACAGG - Intergenic
973600059 4:52533142-52533164 AACAGATTCCCTCTTAGCACTGG - Intergenic
973757535 4:54090687-54090709 AATAATGACCCTCTTCTCACAGG - Intronic
976230498 4:82837797-82837819 TACCCAATCCCACTTCTCACTGG + Intronic
977061569 4:92264338-92264360 AAGTTAATCCCACTTCTCACTGG + Intergenic
977124531 4:93148749-93148771 GACAAAATCCCTGTCCTCACAGG - Intronic
977373740 4:96172821-96172843 AACAAAATCCCTATTTTCCTAGG + Intergenic
977962369 4:103100536-103100558 TACACAATCACTCTGCTCACTGG - Intergenic
978111620 4:104971119-104971141 AATGAACTCCCTCTGCTCACAGG + Intergenic
978472034 4:109078983-109079005 AAAAAAATCCATGTTTTCACTGG + Intronic
978828092 4:113048702-113048724 AACACAATCCCTCCTCTCAAGGG - Intronic
979210897 4:118100652-118100674 AACATGAACCCTCTTATCACTGG - Intronic
980197376 4:129607932-129607954 AACAAAATCACTCATGTCATTGG - Intergenic
981437815 4:144747000-144747022 CACATCATCTCTCTTCTCACTGG - Intergenic
982986401 4:162212857-162212879 AACAAAGTCACTCTTATTACTGG + Intergenic
983116382 4:163821779-163821801 AAAAAAAACCCTCTTTTCCCAGG - Intronic
984686310 4:182672263-182672285 AACAAAACCTCTTTTCTCCCTGG - Intronic
984925508 4:184802985-184803007 CACAGAACCCCTGTTCTCACAGG - Intronic
985088618 4:186341184-186341206 GACAAAATTCCTCTTGTAACAGG + Intergenic
986744193 5:10730176-10730198 AACAAAATCCCTCTTCTCACAGG - Intronic
987159472 5:15126207-15126229 TACAAAATCCCTGAACTCACAGG - Intergenic
988120084 5:26950216-26950238 AACAATATTCCACTTGTCACAGG - Intronic
988768795 5:34410167-34410189 GCAAAAATCCCTCTTCTCACAGG - Intergenic
988812285 5:34797427-34797449 AAAAAAAACCCTATTCTCAAAGG - Intronic
992409943 5:76495520-76495542 ACCATCATCCCTCTCCTCACAGG + Intronic
993600399 5:89916154-89916176 AACAAAATCCAGCTTCACATGGG + Intergenic
994031803 5:95151755-95151777 AGCAAAATCCTTCTTTCCACAGG + Intronic
996064534 5:119066800-119066822 AAAAAAATCCCTATTCTCCCAGG - Intronic
996392615 5:122978369-122978391 AACAAAAGCCGTCTTCTCAGGGG + Intronic
997444007 5:133928251-133928273 AACAAAATCCCTGTCCTCCTGGG + Intergenic
998822600 5:146070216-146070238 ACCTTAATCCCTCTTCTCAATGG + Intronic
1003860467 6:10318024-10318046 ACCACGATCCCTCCTCTCACAGG - Intergenic
1004292669 6:14382721-14382743 AATCCCATCCCTCTTCTCACTGG + Intergenic
1005141517 6:22637231-22637253 AACAACATCCCTCTTACCTCAGG - Intergenic
1006268074 6:32941860-32941882 AACAAAATCTGTCTTTTCAGGGG - Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1008595408 6:53036825-53036847 AAGAATATCATTCTTCTCACTGG + Intronic
1010082794 6:71884180-71884202 ATCTAACTCCCTCTTCTTACTGG - Intergenic
1011531491 6:88327251-88327273 AACAAAATCCAACTGCTTACAGG + Intergenic
1012187704 6:96241115-96241137 AATAAAATCCCTTTTTTAACAGG - Intergenic
1012468637 6:99544570-99544592 AAAAAAAACCCTCTTAGCACAGG + Intronic
1012716202 6:102674126-102674148 ATCAAAATCCTTCTTCTTAATGG + Intergenic
1013606329 6:111752476-111752498 AACAAAATGTCTCTCCTCAATGG - Intronic
1017904926 6:158751442-158751464 AGCAGAATCCCACTTCTCAGCGG + Intronic
1018045996 6:159967325-159967347 CACAAAATACCTCTTCACAATGG - Intergenic
1018595893 6:165480178-165480200 AACATAATCCCTATACTCAAAGG + Intronic
1021966414 7:25924154-25924176 AACACAAGCCCCCTTCTCCCAGG - Intergenic
1022090638 7:27105915-27105937 AAATAAATCCCTATTCTCCCTGG - Intergenic
1022205201 7:28157209-28157231 CACTAAGTCCCTCTTCCCACAGG + Intronic
1025262943 7:57433007-57433029 AAAAAAATGTCTCTTCTGACTGG - Intergenic
1026201416 7:68217908-68217930 AACAAAATCCTTGTCCTCAGAGG - Intergenic
1026733045 7:72927874-72927896 GACAAAATCCCTGCTCTCATGGG + Intronic
1028008422 7:85609311-85609333 AAAAATACCACTCTTCTCACTGG + Intergenic
1028229546 7:88290105-88290127 AACAAAATCCATCTCATTACAGG - Intronic
1034377250 7:150656926-150656948 AACAAAATGCCTCCTCTAATAGG - Intergenic
1037562446 8:20087140-20087162 AACATAATCTCACTTCCCACTGG + Intergenic
1037800934 8:22035196-22035218 AGCTACATCCCTCTTCTCAATGG + Intronic
1038193466 8:25345239-25345261 AAAAAAATGACCCTTCTCACAGG - Intronic
1038696481 8:29811209-29811231 AACAACTTCCATCTTCTCAGGGG - Intergenic
1039036151 8:33361286-33361308 AAAAAAATGCCTCCTCTCCCGGG + Intergenic
1042676664 8:71329009-71329031 AACAGAATCTCTGTTCTCATAGG + Intronic
1043339316 8:79218469-79218491 AACTGAATTCCTTTTCTCACTGG - Intergenic
1043380711 8:79699051-79699073 AACAAAAACCCTCTTTACACAGG + Intergenic
1044910853 8:97056815-97056837 AACAAGATCCCTGCTCTCATGGG + Intronic
1045023337 8:98063365-98063387 AAAAAAAAGCCTGTTCTCACCGG + Intergenic
1045070116 8:98494344-98494366 AACAGCATCCCTTTTCTCTCAGG + Intronic
1046061208 8:109141888-109141910 AACAAAAACCCTTTTATCATAGG - Intergenic
1046349650 8:112990628-112990650 AACAAAATCTGTCTTGTCTCAGG - Intronic
1046985037 8:120378572-120378594 AACTAAATCTCCCTTGTCACTGG + Intergenic
1048394381 8:134000067-134000089 AAGAAAGCCCCTGTTCTCACAGG + Intergenic
1050981484 9:12021434-12021456 CACAAAATCTCTTTTCTCAAGGG + Intergenic
1051407374 9:16753414-16753436 AAGAAAAGCACTCTTCACACGGG + Intronic
1055283112 9:74697473-74697495 AACAAATACCCTCTTCACATAGG - Intergenic
1056436205 9:86577947-86577969 AATAACATCCAGCTTCTCACAGG - Intergenic
1056946702 9:91003787-91003809 AACAAACCACCTCTTCTCTCAGG + Intergenic
1056999589 9:91495299-91495321 AACGAAATGCTTCCTCTCACAGG + Intergenic
1057330635 9:94111517-94111539 AACAAAATCCTGTTTCTCAGTGG + Intergenic
1057486910 9:95492806-95492828 AAAAAAATGCATCTCCTCACTGG - Intronic
1057995409 9:99818889-99818911 AACAAAAAAACTCTTCTCCCTGG - Intergenic
1058944700 9:109845490-109845512 CACACAATTCCTCTGCTCACTGG - Intronic
1059356351 9:113702354-113702376 TGCAAAATCCCTCTCCACACAGG + Intergenic
1059615230 9:115943585-115943607 GACAAAATCCCCCTTCTGTCAGG + Intergenic
1060143393 9:121230023-121230045 AAAAATATCCCTCTACTCAAAGG - Intronic
1060510743 9:124230168-124230190 AATAAAGTCCCTCTTCTCAAGGG + Intergenic
1060664007 9:125422173-125422195 AACAAACACCCTCTTCTCCCAGG - Intergenic
1060905908 9:127305327-127305349 AAAAAAATCCCACTTTTCCCAGG - Intronic
1187408572 X:19026207-19026229 AAACAAATCCCTCTTCTTATGGG - Intronic
1188328291 X:28835069-28835091 AACATTATACCTCTTCTGACTGG - Intronic
1189064716 X:37795180-37795202 ACTAAAGTCCCTTTTCTCACAGG + Intronic
1189132587 X:38515935-38515957 GCCAACATCCCTCTTCTTACAGG - Intronic
1189278096 X:39801866-39801888 ACCAAAATTCCTCTTCCCAAAGG - Intergenic
1189560699 X:42188708-42188730 AGAAAAATCCCCCTACTCACAGG - Intergenic
1192235408 X:69292346-69292368 AACACAGTCCCTCTGCTCAGAGG + Intergenic
1192319408 X:70077368-70077390 ATTAAAATACCTCTTCTCCCTGG + Intergenic
1194555977 X:95360352-95360374 TACAATATCCCTTTTCTCACAGG + Intergenic
1195320387 X:103717048-103717070 AACATAATCCATCTGCTCCCAGG - Intronic
1195606275 X:106809241-106809263 AACAAAGTCCCTACTCTCATGGG + Intronic
1196498586 X:116351077-116351099 GACAGCAGCCCTCTTCTCACAGG - Intergenic
1196687211 X:118521569-118521591 AACACATTCCCTCTTTTAACAGG - Intronic
1198708695 X:139477864-139477886 AGCAAAATTCCTCTCCTCTCTGG + Intergenic
1199929741 X:152506339-152506361 GACAGTAGCCCTCTTCTCACAGG + Intergenic
1202242426 Y:22785559-22785581 AACCAGCTCCCTCTGCTCACGGG + Intergenic
1202395411 Y:24419308-24419330 AACCAGCTCCCTCTGCTCACGGG + Intergenic
1202475374 Y:25250784-25250806 AACCAGCTCCCTCTGCTCACGGG - Intergenic