ID: 986748619

View in Genome Browser
Species Human (GRCh38)
Location 5:10765221-10765243
Sequence CCCATCATGCAGGGTCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986748619_986748634 28 Left 986748619 5:10765221-10765243 CCTACCAGACCCTGCATGATGGG No data
Right 986748634 5:10765272-10765294 CTTGGCTCCTCTGGCCACACTGG No data
986748619_986748629 10 Left 986748619 5:10765221-10765243 CCTACCAGACCCTGCATGATGGG No data
Right 986748629 5:10765254-10765276 AGTTGTGAGCTCCTCCCTCTTGG No data
986748619_986748630 19 Left 986748619 5:10765221-10765243 CCTACCAGACCCTGCATGATGGG No data
Right 986748630 5:10765263-10765285 CTCCTCCCTCTTGGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986748619 Original CRISPR CCCATCATGCAGGGTCTGGT AGG (reversed) Intergenic
No off target data available for this crispr