ID: 986749721

View in Genome Browser
Species Human (GRCh38)
Location 5:10776143-10776165
Sequence GTGGAGTCCACTCCTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986749721_986749728 10 Left 986749721 5:10776143-10776165 CCCACAGCAGGAGTGGACTCCAC No data
Right 986749728 5:10776176-10776198 TCAGCTTAGCCTGGGAAGTTTGG No data
986749721_986749730 20 Left 986749721 5:10776143-10776165 CCCACAGCAGGAGTGGACTCCAC No data
Right 986749730 5:10776186-10776208 CTGGGAAGTTTGGATTTCTTTGG No data
986749721_986749726 2 Left 986749721 5:10776143-10776165 CCCACAGCAGGAGTGGACTCCAC No data
Right 986749726 5:10776168-10776190 CAAGATCCTCAGCTTAGCCTGGG No data
986749721_986749725 1 Left 986749721 5:10776143-10776165 CCCACAGCAGGAGTGGACTCCAC No data
Right 986749725 5:10776167-10776189 CCAAGATCCTCAGCTTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986749721 Original CRISPR GTGGAGTCCACTCCTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr