ID: 986751106

View in Genome Browser
Species Human (GRCh38)
Location 5:10788550-10788572
Sequence CTGCTGTCCATGCTAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986751099_986751106 16 Left 986751099 5:10788511-10788533 CCTTCCTGCGTGACTGTCCTCGC No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751098_986751106 17 Left 986751098 5:10788510-10788532 CCCTTCCTGCGTGACTGTCCTCG No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751100_986751106 12 Left 986751100 5:10788515-10788537 CCTGCGTGACTGTCCTCGCTAGT No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751102_986751106 -1 Left 986751102 5:10788528-10788550 CCTCGCTAGTCCCTGCTGGCCTC No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751096_986751106 21 Left 986751096 5:10788506-10788528 CCGCCCCTTCCTGCGTGACTGTC No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751097_986751106 18 Left 986751097 5:10788509-10788531 CCCCTTCCTGCGTGACTGTCCTC No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data
986751095_986751106 24 Left 986751095 5:10788503-10788525 CCTCCGCCCCTTCCTGCGTGACT No data
Right 986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986751106 Original CRISPR CTGCTGTCCATGCTAAGCAC AGG Intergenic
No off target data available for this crispr