ID: 986751881

View in Genome Browser
Species Human (GRCh38)
Location 5:10794816-10794838
Sequence CATCAGAGTGAGAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986751881_986751889 11 Left 986751881 5:10794816-10794838 CCCTGCACCCTCTCACTCTGATG No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751881_986751895 19 Left 986751881 5:10794816-10794838 CCCTGCACCCTCTCACTCTGATG No data
Right 986751895 5:10794858-10794880 CAGAAGCAGAACTGGAGCTGGGG No data
986751881_986751894 18 Left 986751881 5:10794816-10794838 CCCTGCACCCTCTCACTCTGATG No data
Right 986751894 5:10794857-10794879 CCAGAAGCAGAACTGGAGCTGGG No data
986751881_986751892 17 Left 986751881 5:10794816-10794838 CCCTGCACCCTCTCACTCTGATG No data
Right 986751892 5:10794856-10794878 CCCAGAAGCAGAACTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986751881 Original CRISPR CATCAGAGTGAGAGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr