ID: 986751889

View in Genome Browser
Species Human (GRCh38)
Location 5:10794850-10794872
Sequence TAGTTCCCCAGAAGCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986751879_986751889 15 Left 986751879 5:10794812-10794834 CCACCCCTGCACCCTCTCACTCT No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751884_986751889 4 Left 986751884 5:10794823-10794845 CCCTCTCACTCTGATGCCAAGGG No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751880_986751889 12 Left 986751880 5:10794815-10794837 CCCCTGCACCCTCTCACTCTGAT No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751882_986751889 10 Left 986751882 5:10794817-10794839 CCTGCACCCTCTCACTCTGATGC No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751876_986751889 28 Left 986751876 5:10794799-10794821 CCGAAAGGTCTCCCCACCCCTGC No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751878_986751889 16 Left 986751878 5:10794811-10794833 CCCACCCCTGCACCCTCTCACTC No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751877_986751889 17 Left 986751877 5:10794810-10794832 CCCCACCCCTGCACCCTCTCACT No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751886_986751889 3 Left 986751886 5:10794824-10794846 CCTCTCACTCTGATGCCAAGGGC No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data
986751881_986751889 11 Left 986751881 5:10794816-10794838 CCCTGCACCCTCTCACTCTGATG No data
Right 986751889 5:10794850-10794872 TAGTTCCCCAGAAGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986751889 Original CRISPR TAGTTCCCCAGAAGCAGAAC TGG Intergenic
No off target data available for this crispr